Incidental Mutation 'R6146:Olfr477'
ID488878
Institutional Source Beutler Lab
Gene Symbol Olfr477
Ensembl Gene ENSMUSG00000096151
Gene Nameolfactory receptor 477
SynonymsGA_x6K02T2PBJ9-10319672-10320604, MOR204-1
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6146 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107986693-107992723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107990413 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 16 (G16V)
Ref Sequence ENSEMBL: ENSMUSP00000091654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091605] [ENSMUST00000214677]
Predicted Effect probably damaging
Transcript: ENSMUST00000091605
AA Change: G16V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091654
Gene: ENSMUSG00000096151
AA Change: G16V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 290 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214677
AA Change: G16V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Ankrd2 A G 19: 42,040,105 T67A possibly damaging Het
Anln A T 9: 22,376,308 C232* probably null Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Dcdc2a T C 13: 25,205,457 V456A probably benign Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Kidins220 G A 12: 25,052,813 R1238Q probably damaging Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Lzts1 A G 8: 69,140,872 S28P probably benign Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Muc16 T A 9: 18,497,797 N198Y probably damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Prl8a8 T C 13: 27,510,480 Y108C probably damaging Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Rps24 A T 14: 24,490,735 probably null Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Olfr477
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Olfr477 APN 7 107990890 missense probably damaging 0.97
IGL01078:Olfr477 APN 7 107990943 missense probably benign 0.02
IGL01141:Olfr477 APN 7 107990551 missense probably damaging 1.00
IGL02613:Olfr477 APN 7 107991174 nonsense probably null
R0625:Olfr477 UTSW 7 107991189 missense probably damaging 1.00
R0791:Olfr477 UTSW 7 107990533 missense probably benign 0.27
R1254:Olfr477 UTSW 7 107990440 missense probably benign 0.01
R1456:Olfr477 UTSW 7 107990398 missense probably benign 0.06
R1522:Olfr477 UTSW 7 107990533 missense probably benign 0.27
R1541:Olfr477 UTSW 7 107990841 missense probably benign 0.10
R2889:Olfr477 UTSW 7 107990577 missense probably benign 0.06
R5653:Olfr477 UTSW 7 107990385 missense probably benign 0.38
R6190:Olfr477 UTSW 7 107991100 missense probably damaging 1.00
R7103:Olfr477 UTSW 7 107990598 missense possibly damaging 0.92
R7191:Olfr477 UTSW 7 107990646 missense possibly damaging 0.88
R7553:Olfr477 UTSW 7 107990475 missense probably benign 0.03
R7681:Olfr477 UTSW 7 107991148 missense possibly damaging 0.80
Z1088:Olfr477 UTSW 7 107990731 missense probably benign 0.42
Z1177:Olfr477 UTSW 7 107991094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCACCTTGAGGGAAAGATCTC -3'
(R):5'- ACCCAATGTCTACAAGAGCTAG -3'

Sequencing Primer
(F):5'- TTGAGGGAAAGATCTCTGAAGTC -3'
(R):5'- CCAATGTCTACAAGAGCTAGATGGC -3'
Posted On2017-10-10