Incidental Mutation 'R6146:Muc16'
ID 488881
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R6146 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 18495455-18674530 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18497797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 198 (N198Y)
Ref Sequence ENSEMBL: ENSMUSP00000034653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034653] [ENSMUST00000208663]
AlphaFold no structure available at present
PDB Structure Solution structure of the SEA domain from murine hypothetical protein homologous to human mucin 16 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034653
AA Change: N198Y

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034653
Gene: ENSMUSG00000109564
AA Change: N198Y

DomainStartEndE-ValueType
Pfam:SEA 71 174 9.6e-30 PFAM
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207857
AA Change: N2505Y
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: N8418Y

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Ankrd2 A G 19: 42,040,105 T67A possibly damaging Het
Anln A T 9: 22,376,308 C232* probably null Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Dcdc2a T C 13: 25,205,457 V456A probably benign Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Kidins220 G A 12: 25,052,813 R1238Q probably damaging Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Lzts1 A G 8: 69,140,872 S28P probably benign Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Olfr477 G T 7: 107,990,413 G16V probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Prl8a8 T C 13: 27,510,480 Y108C probably damaging Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Rps24 A T 14: 24,490,735 probably null Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R7038_muc16_859 UTSW 9 18620468 missense probably damaging 0.99
Runneymeade UTSW 9 18579317 critical splice donor site probably null
slimey UTSW 9 18590698 missense probably damaging 1.00
viscous UTSW 9 18644732 missense unknown
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 splice site probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 splice site probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7921:Muc16 UTSW 9 18659318 missense unknown
R7922:Muc16 UTSW 9 18584825 missense probably benign 0.16
R7948:Muc16 UTSW 9 18642490 missense unknown
R7957:Muc16 UTSW 9 18643471 missense unknown
R7972:Muc16 UTSW 9 18645764 nonsense probably null
R7992:Muc16 UTSW 9 18656429 missense unknown
R7998:Muc16 UTSW 9 18639892 missense probably benign 0.04
R8014:Muc16 UTSW 9 18654875 missense unknown
R8033:Muc16 UTSW 9 18636606 missense probably benign 0.26
R8052:Muc16 UTSW 9 18659051 missense unknown
R8058:Muc16 UTSW 9 18660002 nonsense probably null
R8088:Muc16 UTSW 9 18519300 nonsense probably null
R8095:Muc16 UTSW 9 18584830 nonsense probably null
R8111:Muc16 UTSW 9 18592629 missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18658737 missense unknown
R8117:Muc16 UTSW 9 18508910 nonsense probably null
R8137:Muc16 UTSW 9 18645676 missense unknown
R8196:Muc16 UTSW 9 18645334 missense unknown
R8218:Muc16 UTSW 9 18637019 missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18642977 missense unknown
R8313:Muc16 UTSW 9 18525147 missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18658043 missense unknown
R8342:Muc16 UTSW 9 18658685 missense unknown
R8351:Muc16 UTSW 9 18659885 missense unknown
R8356:Muc16 UTSW 9 18658778 missense unknown
R8360:Muc16 UTSW 9 18525258 missense probably benign 0.01
R8418:Muc16 UTSW 9 18519630 missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18537511 missense probably damaging 0.99
R8437:Muc16 UTSW 9 18657924 missense unknown
R8463:Muc16 UTSW 9 18659139 missense unknown
R8466:Muc16 UTSW 9 18643148 missense unknown
R8512:Muc16 UTSW 9 18638192 missense probably benign 0.01
R8518:Muc16 UTSW 9 18519631 missense probably benign 0.12
R8556:Muc16 UTSW 9 18640937 missense probably benign 0.01
R8679:Muc16 UTSW 9 18646448 missense unknown
R8680:Muc16 UTSW 9 18644719 missense unknown
R8720:Muc16 UTSW 9 18641600 missense probably benign 0.01
R8729:Muc16 UTSW 9 18660050 missense unknown
R8736:Muc16 UTSW 9 18550843 nonsense probably null
R8739:Muc16 UTSW 9 18637298 missense probably benign 0.10
R8807:Muc16 UTSW 9 18656057 missense unknown
R8830:Muc16 UTSW 9 18646069 missense unknown
R8871:Muc16 UTSW 9 18656048 missense unknown
R8884:Muc16 UTSW 9 18644200 missense unknown
R8923:Muc16 UTSW 9 18638676 missense probably benign 0.01
R8948:Muc16 UTSW 9 18647233 missense unknown
R8949:Muc16 UTSW 9 18520925 critical splice donor site probably null
R8987:Muc16 UTSW 9 18551685 nonsense probably null
R9013:Muc16 UTSW 9 18512773 missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18638719 small insertion probably benign
R9036:Muc16 UTSW 9 18644679 missense unknown
R9040:Muc16 UTSW 9 18644786 nonsense probably null
R9065:Muc16 UTSW 9 18643009 missense unknown
R9089:Muc16 UTSW 9 18644550 missense unknown
R9098:Muc16 UTSW 9 18643679 missense unknown
R9100:Muc16 UTSW 9 18645670 missense unknown
R9128:Muc16 UTSW 9 18647582 missense unknown
R9169:Muc16 UTSW 9 18656528 missense unknown
R9180:Muc16 UTSW 9 18642742 missense unknown
R9191:Muc16 UTSW 9 18644810 missense unknown
R9203:Muc16 UTSW 9 18551688 missense unknown
R9208:Muc16 UTSW 9 18508537 missense probably damaging 0.99
R9232:Muc16 UTSW 9 18656040 missense unknown
R9240:Muc16 UTSW 9 18538013 missense unknown
R9254:Muc16 UTSW 9 18646171 missense unknown
R9330:Muc16 UTSW 9 18641036 missense probably benign 0.04
R9347:Muc16 UTSW 9 18660215 missense unknown
R9358:Muc16 UTSW 9 18642224 missense probably benign 0.01
R9359:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9379:Muc16 UTSW 9 18646171 missense unknown
R9403:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9422:Muc16 UTSW 9 18641806 missense probably benign 0.01
R9433:Muc16 UTSW 9 18572641 missense probably benign 0.09
R9438:Muc16 UTSW 9 18647732 missense unknown
Z1177:Muc16 UTSW 9 18537571 missense probably benign 0.26
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTATGGGTCTCAAGCAGGAC -3'
(R):5'- ACCTTGGATTTTACACTGAGCTTC -3'

Sequencing Primer
(F):5'- GGACAAAAACTATGTCTGTGCACTC -3'
(R):5'- CCAGCACTCAGTAGGAAGCTG -3'
Posted On 2017-10-10