Mutagenetix > Incidental Mutations

Incidental Mutation 'R6146:Muc16'

488881

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

044293-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R6146 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18497797 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 198 (N198Y)

Ref Sequence

ENSEMBL: ENSMUSP00000034653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034653] [ENSMUST00000208663]

PDB Structure

Solution structure of the SEA domain from murine hypothetical protein homologous to human mucin 16 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034653
AA Change: N198Y

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034653
Gene: ENSMUSG00000109564
AA Change: N198Y

Domain	Start	End	E-Value	Type
Pfam:SEA	71	174	9.6e-30	PFAM
transmembrane domain	205	227	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000207857
AA Change: N2505Y

Predicted Effect

probably benign
Transcript: ENSMUST00000208663
AA Change: N8418Y

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	G	5: 8,896,587	E29G	probably benign	Het
Abi3bp	T	C	16: 56,671,265	S552P	probably damaging	Het
Adgrg7	A	G	16: 56,773,466	I129T	probably benign	Het
Adhfe1	A	G	1: 9,553,718	N148S	probably damaging	Het
AI182371	A	G	2: 35,097,971	Y77H	probably damaging	Het
Aldh5a1	C	T	13: 24,919,678		probably null	Het
Ankrd2	A	G	19: 42,040,105	T67A	possibly damaging	Het
Anln	A	T	9: 22,376,308	C232*	probably null	Het
C330027C09Rik	A	T	16: 48,994,329	K18*	probably null	Het
Cchcr1	A	G	17: 35,528,578	D587G	possibly damaging	Het
Cgn	G	T	3: 94,767,125	Q901K	possibly damaging	Het
Cluh	G	T	11: 74,667,228		probably null	Het
Crebbp	G	A	16: 4,084,623	Q2213*	probably null	Het
Cyp2d22	T	A	15: 82,373,835		probably null	Het
Dcdc2a	T	C	13: 25,205,457	V456A	probably benign	Het
Depdc5	A	G	5: 32,968,731	E569G	probably benign	Het
Dnah5	T	C	15: 28,459,185	F4517L	probably benign	Het
Doc2b	T	C	11: 75,773,595	K317E	probably damaging	Het
Dysf	T	A	6: 84,203,199	D1951E	probably damaging	Het
Epha6	C	A	16: 60,424,835	A334S	possibly damaging	Het
F2rl2	A	C	13: 95,700,641	I65L	probably benign	Het
Fbxw17	A	G	13: 50,432,512	K417E	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fxr2	A	G	11: 69,641,339	M96V	possibly damaging	Het
Kcnj10	C	A	1: 172,369,325	Y135*	probably null	Het
Kidins220	G	A	12: 25,052,813	R1238Q	probably damaging	Het
Krt31	T	C	11: 100,048,230	N255S	probably benign	Het
Lrp2	T	C	2: 69,511,001	D945G	probably benign	Het
Lrrc66	T	C	5: 73,608,089	D537G	probably benign	Het
Ltbp4	T	A	7: 27,319,724	I992F	probably damaging	Het
Lzts1	A	G	8: 69,140,872	S28P	probably benign	Het
Mrc2	C	A	11: 105,325,644	N86K	probably damaging	Het
Mroh6	C	A	15: 75,886,637	A302S	possibly damaging	Het
Myo9a	T	C	9: 59,871,229	S1423P	probably benign	Het
Olfr1006	T	A	2: 85,674,594	K186*	probably null	Het
Olfr1124	A	T	2: 87,435,318	D277V	possibly damaging	Het
Olfr1141	A	C	2: 87,753,258	L245R	probably damaging	Het
Olfr1367	A	T	13: 21,346,994	Y22F	possibly damaging	Het
Olfr190	A	G	16: 59,074,714	V122A	probably benign	Het
Olfr477	G	T	7: 107,990,413	G16V	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Polg	T	C	7: 79,450,512	M1184V	probably benign	Het
Prl8a8	T	C	13: 27,510,480	Y108C	probably damaging	Het
Proser1	T	A	3: 53,478,119	I474N	probably damaging	Het
Rab44	A	G	17: 29,135,417		probably benign	Het
Rbp1	C	A	9: 98,425,616	D79E	possibly damaging	Het
Rnf213	T	C	11: 119,435,999	V1605A	probably benign	Het
Rps24	A	T	14: 24,490,735		probably null	Het
Setd5	T	C	6: 113,121,812		probably null	Het
Slc38a3	T	C	9: 107,655,029	I435V	probably benign	Het
Slco1a5	T	A	6: 142,234,808	M623L	probably benign	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Spn	A	G	7: 127,136,307	S343P	possibly damaging	Het
Sptan1	A	G	2: 30,004,523	T1168A	probably benign	Het
Sptbn4	A	T	7: 27,364,587	L2138*	probably null	Het
Tg	T	A	15: 66,673,367		probably null	Het
Tigd5	T	A	15: 75,910,245	L152Q	probably damaging	Het
Tmem163	C	T	1: 127,519,389	V170I	probably benign	Het
Tpr	T	C	1: 150,423,162	C1068R	possibly damaging	Het
Ttc37	A	G	13: 76,185,240	E1536G	probably damaging	Het
Ubr1	A	T	2: 120,893,209	Y1290N	probably damaging	Het
Vmn1r184	T	A	7: 26,267,392	F188I	probably benign	Het
Vmn2r100	G	A	17: 19,522,260	V299I	probably benign	Het
Vmn2r91	T	G	17: 18,136,256	H728Q	probably benign	Het
Vta1	T	C	10: 14,705,352	Y37C	probably damaging	Het
Wbp2	C	A	11: 116,083,902	M35I	probably benign	Het
Zcchc9	G	A	13: 91,805,867	Q90*	probably null	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGTATGGGTCTCAAGCAGGAC -3'
(R):5'- ACCTTGGATTTTACACTGAGCTTC -3'

Sequencing Primer
(F):5'- GGACAAAAACTATGTCTGTGCACTC -3'
(R):5'- CCAGCACTCAGTAGGAAGCTG -3'

Posted On

2017-10-10