Incidental Mutation 'R6146:Anln'
ID488882
Institutional Source Beutler Lab
Gene Symbol Anln
Ensembl Gene ENSMUSG00000036777
Gene Nameanillin, actin binding protein
Synonyms1110037A17Rik, 2900037I21Rik, Scraps
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6146 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location22332012-22389188 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22376308 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 232 (C232*)
Ref Sequence ENSEMBL: ENSMUSP00000045873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040912]
Predicted Effect probably null
Transcript: ENSMUST00000040912
AA Change: C232*
SMART Domains Protein: ENSMUSP00000045873
Gene: ENSMUSG00000036777
AA Change: C232*

DomainStartEndE-ValueType
low complexity region 97 121 N/A INTRINSIC
Pfam:Anillin_N 141 227 5e-34 PFAM
low complexity region 234 250 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
Pfam:Anillin_N 423 501 2.7e-6 PFAM
coiled coil region 566 599 N/A INTRINSIC
coiled coil region 710 729 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
Pfam:Anillin 797 950 8.8e-39 PFAM
PH 981 1106 1.8e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215486
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin-binding protein that plays a role in cell growth and migration, and in cytokinesis. The encoded protein is thought to regulate actin cytoskeletal dynamics in podocytes, components of the glomerulus. Mutations in this gene are associated with focal segmental glomerulosclerosis 8. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Ankrd2 A G 19: 42,040,105 T67A possibly damaging Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Dcdc2a T C 13: 25,205,457 V456A probably benign Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Kidins220 G A 12: 25,052,813 R1238Q probably damaging Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Lzts1 A G 8: 69,140,872 S28P probably benign Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Muc16 T A 9: 18,497,797 N198Y probably damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Olfr477 G T 7: 107,990,413 G16V probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Prl8a8 T C 13: 27,510,480 Y108C probably damaging Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Rps24 A T 14: 24,490,735 probably null Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Anln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Anln APN 9 22360824 nonsense probably null
IGL01634:Anln APN 9 22360475 missense probably benign 0.00
IGL02145:Anln APN 9 22338996 splice site probably null
IGL02296:Anln APN 9 22372187 missense possibly damaging 0.67
IGL02352:Anln APN 9 22368412 missense probably benign 0.00
IGL02601:Anln APN 9 22338035 missense probably damaging 0.99
IGL02821:Anln APN 9 22358122 missense possibly damaging 0.55
IGL02863:Anln APN 9 22376365 missense probably damaging 1.00
IGL03274:Anln APN 9 22382269 missense probably damaging 1.00
R0114:Anln UTSW 9 22353346 missense probably damaging 0.99
R0486:Anln UTSW 9 22352826 missense probably benign 0.31
R0712:Anln UTSW 9 22380298 missense probably benign 0.01
R1618:Anln UTSW 9 22350918 critical splice donor site probably null
R1734:Anln UTSW 9 22350955 missense possibly damaging 0.71
R1856:Anln UTSW 9 22353331 missense probably damaging 1.00
R1999:Anln UTSW 9 22333052 makesense probably null
R2073:Anln UTSW 9 22333168 missense probably benign 0.45
R2075:Anln UTSW 9 22333168 missense probably benign 0.45
R2696:Anln UTSW 9 22360963 missense probably benign 0.08
R2943:Anln UTSW 9 22356046 splice site probably null
R4278:Anln UTSW 9 22334000 critical splice donor site probably null
R4548:Anln UTSW 9 22362888 missense possibly damaging 0.80
R4887:Anln UTSW 9 22380188 missense possibly damaging 0.46
R4979:Anln UTSW 9 22376501 missense probably benign
R5087:Anln UTSW 9 22375044 missense possibly damaging 0.61
R5197:Anln UTSW 9 22352781 critical splice donor site probably null
R5353:Anln UTSW 9 22360517 missense probably damaging 1.00
R5748:Anln UTSW 9 22337934 missense probably damaging 0.97
R5863:Anln UTSW 9 22337984 missense probably damaging 0.99
R6152:Anln UTSW 9 22360507 missense probably damaging 0.98
R6170:Anln UTSW 9 22368497 missense probably benign 0.01
R6261:Anln UTSW 9 22364046 missense probably damaging 1.00
R6264:Anln UTSW 9 22334117 missense possibly damaging 0.82
R6656:Anln UTSW 9 22351002 missense probably damaging 1.00
R6864:Anln UTSW 9 22382249 missense probably benign 0.36
R7514:Anln UTSW 9 22360857 missense probably damaging 0.96
R7789:Anln UTSW 9 22352037 missense
R7807:Anln UTSW 9 22360880 missense probably damaging 1.00
R7840:Anln UTSW 9 22362723 missense probably benign 0.03
R7912:Anln UTSW 9 22358669 missense possibly damaging 0.53
R7923:Anln UTSW 9 22362723 missense probably benign 0.03
R7993:Anln UTSW 9 22358669 missense possibly damaging 0.53
Z1088:Anln UTSW 9 22362801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACTGACTCACCACAGAGC -3'
(R):5'- CAGTGGCATCCATAACCTATCC -3'

Sequencing Primer
(F):5'- CCACAGAGCTGGACACTGAG -3'
(R):5'- AGGGCTACATTGAGTCCCTGTC -3'
Posted On2017-10-10