Mutagenetix > Incidental Mutations

Incidental Mutation 'R6146:Mrc2'

488890

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

044293-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6146 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 105325644 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 86 (N86K)

Ref Sequence

ENSEMBL: ENSMUSP00000021038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021038
AA Change: N86K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: N86K

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100335
AA Change: N86K

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: N86K

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142905

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	G	5: 8,896,587	E29G	probably benign	Het
Abi3bp	T	C	16: 56,671,265	S552P	probably damaging	Het
Adgrg7	A	G	16: 56,773,466	I129T	probably benign	Het
Adhfe1	A	G	1: 9,553,718	N148S	probably damaging	Het
AI182371	A	G	2: 35,097,971	Y77H	probably damaging	Het
Aldh5a1	C	T	13: 24,919,678		probably null	Het
Ankrd2	A	G	19: 42,040,105	T67A	possibly damaging	Het
Anln	A	T	9: 22,376,308	C232*	probably null	Het
C330027C09Rik	A	T	16: 48,994,329	K18*	probably null	Het
Cchcr1	A	G	17: 35,528,578	D587G	possibly damaging	Het
Cgn	G	T	3: 94,767,125	Q901K	possibly damaging	Het
Cluh	G	T	11: 74,667,228		probably null	Het
Crebbp	G	A	16: 4,084,623	Q2213*	probably null	Het
Cyp2d22	T	A	15: 82,373,835		probably null	Het
Dcdc2a	T	C	13: 25,205,457	V456A	probably benign	Het
Depdc5	A	G	5: 32,968,731	E569G	probably benign	Het
Dnah5	T	C	15: 28,459,185	F4517L	probably benign	Het
Doc2b	T	C	11: 75,773,595	K317E	probably damaging	Het
Dysf	T	A	6: 84,203,199	D1951E	probably damaging	Het
Epha6	C	A	16: 60,424,835	A334S	possibly damaging	Het
F2rl2	A	C	13: 95,700,641	I65L	probably benign	Het
Fbxw17	A	G	13: 50,432,512	K417E	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fxr2	A	G	11: 69,641,339	M96V	possibly damaging	Het
Kcnj10	C	A	1: 172,369,325	Y135*	probably null	Het
Kidins220	G	A	12: 25,052,813	R1238Q	probably damaging	Het
Krt31	T	C	11: 100,048,230	N255S	probably benign	Het
Lrp2	T	C	2: 69,511,001	D945G	probably benign	Het
Lrrc66	T	C	5: 73,608,089	D537G	probably benign	Het
Ltbp4	T	A	7: 27,319,724	I992F	probably damaging	Het
Lzts1	A	G	8: 69,140,872	S28P	probably benign	Het
Mroh6	C	A	15: 75,886,637	A302S	possibly damaging	Het
Muc16	T	A	9: 18,497,797	N198Y	probably damaging	Het
Myo9a	T	C	9: 59,871,229	S1423P	probably benign	Het
Olfr1006	T	A	2: 85,674,594	K186*	probably null	Het
Olfr1124	A	T	2: 87,435,318	D277V	possibly damaging	Het
Olfr1141	A	C	2: 87,753,258	L245R	probably damaging	Het
Olfr1367	A	T	13: 21,346,994	Y22F	possibly damaging	Het
Olfr190	A	G	16: 59,074,714	V122A	probably benign	Het
Olfr477	G	T	7: 107,990,413	G16V	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Polg	T	C	7: 79,450,512	M1184V	probably benign	Het
Prl8a8	T	C	13: 27,510,480	Y108C	probably damaging	Het
Proser1	T	A	3: 53,478,119	I474N	probably damaging	Het
Rab44	A	G	17: 29,135,417		probably benign	Het
Rbp1	C	A	9: 98,425,616	D79E	possibly damaging	Het
Rnf213	T	C	11: 119,435,999	V1605A	probably benign	Het
Rps24	A	T	14: 24,490,735		probably null	Het
Setd5	T	C	6: 113,121,812		probably null	Het
Slc38a3	T	C	9: 107,655,029	I435V	probably benign	Het
Slco1a5	T	A	6: 142,234,808	M623L	probably benign	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Spn	A	G	7: 127,136,307	S343P	possibly damaging	Het
Sptan1	A	G	2: 30,004,523	T1168A	probably benign	Het
Sptbn4	A	T	7: 27,364,587	L2138*	probably null	Het
Tg	T	A	15: 66,673,367		probably null	Het
Tigd5	T	A	15: 75,910,245	L152Q	probably damaging	Het
Tmem163	C	T	1: 127,519,389	V170I	probably benign	Het
Tpr	T	C	1: 150,423,162	C1068R	possibly damaging	Het
Ttc37	A	G	13: 76,185,240	E1536G	probably damaging	Het
Ubr1	A	T	2: 120,893,209	Y1290N	probably damaging	Het
Vmn1r184	T	A	7: 26,267,392	F188I	probably benign	Het
Vmn2r100	G	A	17: 19,522,260	V299I	probably benign	Het
Vmn2r91	T	G	17: 18,136,256	H728Q	probably benign	Het
Vta1	T	C	10: 14,705,352	Y37C	probably damaging	Het
Wbp2	C	A	11: 116,083,902	M35I	probably benign	Het
Zcchc9	G	A	13: 91,805,867	Q90*	probably null	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2165:Mrc2	UTSW	11	105348431	splice site	probably null
R2265:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3838:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4610:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105337813	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105329235	missense	possibly damaging	0.92
R7422:Mrc2	UTSW	11	105292783	start gained	probably benign
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7640:Mrc2	UTSW	11	105332295	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105332266	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105348003	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105348355	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105343507	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8519:Mrc2	UTSW	11	105347306	missense	possibly damaging	0.62
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105341376	missense	possibly damaging	0.94
Z1176:Mrc2	UTSW	11	105347360	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGAGGTATGATGACTTCCTGTCC -3'
(R):5'- GATGTTCCAATGGCCACTGC -3'

Sequencing Primer
(F):5'- GTCCTGCCTTTCCTTCCAGAG -3'
(R):5'- AATGGCCACTGCGGGTCTG -3'

Posted On

2017-10-10