Incidental Mutation 'R6146:Kidins220'
ID488893
Institutional Source Beutler Lab
Gene Symbol Kidins220
Ensembl Gene ENSMUSG00000036333
Gene Namekinase D-interacting substrate 220
SynonymsC330002I19Rik, 3110039L19Rik
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6146 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location24974925-25063152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25052813 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1238 (R1238Q)
Ref Sequence ENSEMBL: ENSMUSP00000152683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]
Predicted Effect probably damaging
Transcript: ENSMUST00000066652
AA Change: R1268Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: R1268Q

DomainStartEndE-ValueType
ANK 37 66 1.11e-7 SMART
ANK 70 99 2.25e-3 SMART
ANK 103 132 4.78e-7 SMART
ANK 136 165 5.53e-3 SMART
ANK 169 198 2.52e-6 SMART
ANK 202 231 6.26e-2 SMART
ANK 235 264 1.22e-4 SMART
ANK 268 297 6.92e-4 SMART
ANK 301 330 1.57e-2 SMART
ANK 334 363 9.78e-4 SMART
ANK 367 398 4.6e0 SMART
Pfam:KAP_NTPase 440 953 1.2e-112 PFAM
low complexity region 1077 1092 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1382 1396 N/A INTRINSIC
low complexity region 1422 1452 N/A INTRINSIC
low complexity region 1509 1520 N/A INTRINSIC
low complexity region 1544 1555 N/A INTRINSIC
low complexity region 1561 1567 N/A INTRINSIC
low complexity region 1596 1609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220459
AA Change: R1147Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221622
Predicted Effect unknown
Transcript: ENSMUST00000222013
AA Change: R1056Q
Predicted Effect probably benign
Transcript: ENSMUST00000222481
Predicted Effect probably damaging
Transcript: ENSMUST00000222941
AA Change: R1238Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Ankrd2 A G 19: 42,040,105 T67A possibly damaging Het
Anln A T 9: 22,376,308 C232* probably null Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Dcdc2a T C 13: 25,205,457 V456A probably benign Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Lzts1 A G 8: 69,140,872 S28P probably benign Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Muc16 T A 9: 18,497,797 N198Y probably damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Olfr477 G T 7: 107,990,413 G16V probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Prl8a8 T C 13: 27,510,480 Y108C probably damaging Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Rps24 A T 14: 24,490,735 probably null Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Kidins220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Kidins220 APN 12 25038560 splice site probably benign
IGL00959:Kidins220 APN 12 25051133 missense possibly damaging 0.74
IGL00978:Kidins220 APN 12 25057474 missense probably damaging 1.00
IGL01144:Kidins220 APN 12 25010926 missense probably damaging 1.00
IGL01326:Kidins220 APN 12 25038499 missense probably damaging 0.97
IGL01545:Kidins220 APN 12 25040460 missense possibly damaging 0.66
IGL01802:Kidins220 APN 12 24995000 missense probably damaging 1.00
IGL01875:Kidins220 APN 12 25057729 missense probably benign 0.00
IGL02160:Kidins220 APN 12 25004111 missense probably damaging 1.00
IGL02383:Kidins220 APN 12 24997333 splice site probably benign
IGL02673:Kidins220 APN 12 24994992 missense probably damaging 1.00
IGL02800:Kidins220 APN 12 25003093 missense probably damaging 1.00
IGL03345:Kidins220 APN 12 25003045 missense probably damaging 1.00
IGL03379:Kidins220 APN 12 25008448 missense probably damaging 0.99
IGL03412:Kidins220 APN 12 24999345 missense probably damaging 1.00
P0043:Kidins220 UTSW 12 25008156 missense probably damaging 1.00
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0011:Kidins220 UTSW 12 24999352 missense probably damaging 0.99
R0269:Kidins220 UTSW 12 25040512 missense probably damaging 0.98
R0280:Kidins220 UTSW 12 25010141 missense probably damaging 1.00
R0334:Kidins220 UTSW 12 25008069 missense probably damaging 1.00
R1601:Kidins220 UTSW 12 25005088 missense probably benign 0.35
R1778:Kidins220 UTSW 12 25013446 splice site probably benign
R1808:Kidins220 UTSW 12 25003009 missense probably benign 0.00
R1855:Kidins220 UTSW 12 25056591 missense probably damaging 1.00
R1965:Kidins220 UTSW 12 24994906 missense probably damaging 1.00
R1982:Kidins220 UTSW 12 25051194 missense probably benign 0.01
R2069:Kidins220 UTSW 12 24987006 splice site probably benign
R2101:Kidins220 UTSW 12 25057423 missense probably damaging 1.00
R2124:Kidins220 UTSW 12 25041303 critical splice donor site probably null
R2371:Kidins220 UTSW 12 25057324 missense probably damaging 1.00
R2405:Kidins220 UTSW 12 25011509 missense probably damaging 0.99
R3522:Kidins220 UTSW 12 24990758 missense probably damaging 1.00
R3877:Kidins220 UTSW 12 25001565 splice site probably benign
R3915:Kidins220 UTSW 12 25053958 missense possibly damaging 0.93
R4023:Kidins220 UTSW 12 25057144 intron probably null
R4287:Kidins220 UTSW 12 25056846 missense possibly damaging 0.81
R4476:Kidins220 UTSW 12 25011001 missense probably damaging 1.00
R4495:Kidins220 UTSW 12 25038302 intron probably null
R4627:Kidins220 UTSW 12 25057042 missense possibly damaging 0.89
R4807:Kidins220 UTSW 12 25057285 missense probably damaging 1.00
R4899:Kidins220 UTSW 12 25013443 critical splice donor site probably null
R4960:Kidins220 UTSW 12 24992260 nonsense probably null
R5118:Kidins220 UTSW 12 24992297 missense probably damaging 1.00
R5183:Kidins220 UTSW 12 25051126 missense probably benign 0.17
R5238:Kidins220 UTSW 12 25003010 missense probably benign 0.31
R5580:Kidins220 UTSW 12 25047897 missense probably benign 0.00
R5707:Kidins220 UTSW 12 25013391 missense probably damaging 1.00
R5813:Kidins220 UTSW 12 25057140 nonsense probably null
R6131:Kidins220 UTSW 12 24992314 splice site probably null
R6151:Kidins220 UTSW 12 25056909 missense possibly damaging 0.65
R6160:Kidins220 UTSW 12 24997311 missense probably damaging 1.00
R6187:Kidins220 UTSW 12 25051308 intron probably null
R6289:Kidins220 UTSW 12 25056616 missense probably damaging 1.00
R6321:Kidins220 UTSW 12 25057534 missense probably benign 0.09
R6450:Kidins220 UTSW 12 25057191 missense probably benign
R6513:Kidins220 UTSW 12 25038435 missense possibly damaging 0.94
R6652:Kidins220 UTSW 12 25010060 splice site probably null
R6711:Kidins220 UTSW 12 24998751 missense probably damaging 0.96
R6858:Kidins220 UTSW 12 25008543 missense possibly damaging 0.85
R7102:Kidins220 UTSW 12 25057663 missense probably benign 0.00
R7112:Kidins220 UTSW 12 25004019 missense probably damaging 1.00
R7139:Kidins220 UTSW 12 24994821 missense probably damaging 1.00
R7140:Kidins220 UTSW 12 25036624 missense probably damaging 1.00
R7271:Kidins220 UTSW 12 25011571 missense probably benign 0.21
R7361:Kidins220 UTSW 12 25057000 missense probably benign 0.01
R7509:Kidins220 UTSW 12 24982361 missense probably damaging 0.98
R7510:Kidins220 UTSW 12 24992269 missense possibly damaging 0.88
R7783:Kidins220 UTSW 12 24988556 missense probably damaging 1.00
R7796:Kidins220 UTSW 12 24982351 missense probably damaging 0.96
R7831:Kidins220 UTSW 12 25061231 missense possibly damaging 0.90
R7914:Kidins220 UTSW 12 25061231 missense possibly damaging 0.90
R8074:Kidins220 UTSW 12 25057716 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TATTGCTGCCCAGGACAGATC -3'
(R):5'- TGTATCACTTCTGGCCAGTAC -3'

Sequencing Primer
(F):5'- CACTGAAATGCTTGACACTTAGG -3'
(R):5'- AGTACTTCTTCGTACTGGGTTTC -3'
Posted On2017-10-10