Incidental Mutation 'R6146:Dcdc2a'
ID488896
Institutional Source Beutler Lab
Gene Symbol Dcdc2a
Ensembl Gene ENSMUSG00000035910
Gene Namedoublecortin domain containing 2a
SynonymsRU2, Dcdc2
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R6146 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location25056004-25210706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25205457 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 456 (V456A)
Ref Sequence ENSEMBL: ENSMUSP00000063650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069614]
Predicted Effect probably benign
Transcript: ENSMUST00000069614
AA Change: V456A

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000063650
Gene: ENSMUSG00000035910
AA Change: V456A

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
coiled coil region 409 437 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160363
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired short term object recognition, impaired visuo-spatial learning and memory and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Ankrd2 A G 19: 42,040,105 T67A possibly damaging Het
Anln A T 9: 22,376,308 C232* probably null Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Kidins220 G A 12: 25,052,813 R1238Q probably damaging Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Lzts1 A G 8: 69,140,872 S28P probably benign Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Muc16 T A 9: 18,497,797 N198Y probably damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Olfr477 G T 7: 107,990,413 G16V probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Prl8a8 T C 13: 27,510,480 Y108C probably damaging Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Rps24 A T 14: 24,490,735 probably null Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Dcdc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Dcdc2a APN 13 25119329 missense probably benign 0.00
IGL01314:Dcdc2a APN 13 25102604 missense probably damaging 1.00
IGL02171:Dcdc2a APN 13 25056434 missense probably damaging 1.00
IGL02490:Dcdc2a APN 13 25107652 missense probably damaging 1.00
R0128:Dcdc2a UTSW 13 25187672 splice site probably benign
R0130:Dcdc2a UTSW 13 25187672 splice site probably benign
R0366:Dcdc2a UTSW 13 25056434 missense probably damaging 1.00
R0507:Dcdc2a UTSW 13 25102589 missense probably damaging 0.99
R0514:Dcdc2a UTSW 13 25119386 missense probably benign 0.04
R1055:Dcdc2a UTSW 13 25102610 missense probably damaging 0.99
R1170:Dcdc2a UTSW 13 25056307 missense probably benign 0.34
R1301:Dcdc2a UTSW 13 25102586 missense possibly damaging 0.93
R1514:Dcdc2a UTSW 13 25061254 missense probably benign 0.05
R1842:Dcdc2a UTSW 13 25107602 missense probably damaging 1.00
R2060:Dcdc2a UTSW 13 25107710 missense possibly damaging 0.59
R2121:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2122:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2900:Dcdc2a UTSW 13 25120498 missense probably benign 0.01
R3153:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R3154:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R4353:Dcdc2a UTSW 13 25056491 missense probably damaging 1.00
R4608:Dcdc2a UTSW 13 25061240 nonsense probably null
R5099:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R5128:Dcdc2a UTSW 13 25102529 missense probably damaging 1.00
R5181:Dcdc2a UTSW 13 25202364 missense possibly damaging 0.94
R5271:Dcdc2a UTSW 13 25187688 missense probably benign 0.35
R5869:Dcdc2a UTSW 13 25107730 missense probably benign 0.05
R6058:Dcdc2a UTSW 13 25056371 missense possibly damaging 0.82
R6892:Dcdc2a UTSW 13 25056460 missense probably damaging 1.00
R6956:Dcdc2a UTSW 13 25119366 missense probably benign 0.02
R6972:Dcdc2a UTSW 13 25120389 intron probably benign
R6973:Dcdc2a UTSW 13 25120389 intron probably benign
R7097:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R7247:Dcdc2a UTSW 13 25102391 missense probably benign 0.00
R7390:Dcdc2a UTSW 13 25107617 missense possibly damaging 0.89
R7570:Dcdc2a UTSW 13 25119373 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCACGTGAGGTATCAAC -3'
(R):5'- AATGCAATAGGTAGGGCCTC -3'

Sequencing Primer
(F):5'- GTATCAACCAACTAAAGGGCTG -3'
(R):5'- TAGGGCCTCCACCACATTG -3'
Posted On2017-10-10