Incidental Mutation 'R6146:Prl8a8'
ID488897
Institutional Source Beutler Lab
Gene Symbol Prl8a8
Ensembl Gene ENSMUSG00000021346
Gene Nameprolactin family 8, subfamily a, member 81
Synonyms1600032B14Rik, PLP-Cgamma, Prlpc3
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6146 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location27506968-27513217 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27510480 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 108 (Y108C)
Ref Sequence ENSEMBL: ENSMUSP00000153131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018389] [ENSMUST00000110350] [ENSMUST00000223621] [ENSMUST00000224072]
Predicted Effect probably damaging
Transcript: ENSMUST00000018389
AA Change: Y70C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018389
Gene: ENSMUSG00000021346
AA Change: Y70C

DomainStartEndE-ValueType
Pfam:Hormone_1 16 240 2.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110350
AA Change: Y71C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105979
Gene: ENSMUSG00000021346
AA Change: Y71C

DomainStartEndE-ValueType
Pfam:Hormone_1 17 241 3.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223621
AA Change: Y109C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224072
AA Change: Y108C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Ankrd2 A G 19: 42,040,105 T67A possibly damaging Het
Anln A T 9: 22,376,308 C232* probably null Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Dcdc2a T C 13: 25,205,457 V456A probably benign Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Kidins220 G A 12: 25,052,813 R1238Q probably damaging Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Lzts1 A G 8: 69,140,872 S28P probably benign Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Muc16 T A 9: 18,497,797 N198Y probably damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Olfr477 G T 7: 107,990,413 G16V probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Rps24 A T 14: 24,490,735 probably null Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Prl8a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Prl8a8 APN 13 27509610 missense probably damaging 0.96
R0117:Prl8a8 UTSW 13 27508490 missense probably damaging 1.00
R0515:Prl8a8 UTSW 13 27508367 missense probably damaging 0.99
R0602:Prl8a8 UTSW 13 27508550 splice site probably benign
R0708:Prl8a8 UTSW 13 27511545 missense possibly damaging 0.64
R1824:Prl8a8 UTSW 13 27508450 missense probably damaging 1.00
R3416:Prl8a8 UTSW 13 27511549 missense probably damaging 1.00
R4432:Prl8a8 UTSW 13 27510480 missense probably benign 0.41
R6107:Prl8a8 UTSW 13 27511464 missense possibly damaging 0.70
R6398:Prl8a8 UTSW 13 27508429 missense probably damaging 1.00
R6493:Prl8a8 UTSW 13 27507352 nonsense probably null
R7069:Prl8a8 UTSW 13 27511467 missense probably benign 0.30
R7104:Prl8a8 UTSW 13 27511496 missense probably damaging 1.00
R7493:Prl8a8 UTSW 13 27511435 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTGTGAAGGTTAAGAAGTTGAAAAGC -3'
(R):5'- ATGTGTATCCATTACCCCTGTGG -3'

Sequencing Primer
(F):5'- GCTGTCAATTAAGAACAGGGAATAC -3'
(R):5'- GTTCACAGTCAGCTAATGGATGGATC -3'
Posted On2017-10-10