Incidental Mutation 'R6146:Rps24'
ID488902
Institutional Source Beutler Lab
Gene Symbol Rps24
Ensembl Gene ENSMUSG00000025290
Gene Nameribosomal protein S24
SynonymsMRP S24
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R6146 (G1)
Quality Score189.009
Status Not validated
Chromosome14
Chromosomal Location24487125-24496959 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to T at 24490735 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223718] [ENSMUST00000223999] [ENSMUST00000224568] [ENSMUST00000225023]
Predicted Effect probably benign
Transcript: ENSMUST00000026322
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112384
SMART Domains Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 23 108 4.4e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169826
SMART Domains Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 24 102 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223939
Predicted Effect probably null
Transcript: ENSMUST00000223999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224549
Predicted Effect probably null
Transcript: ENSMUST00000224568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225014
Predicted Effect probably null
Transcript: ENSMUST00000225023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225994
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Ankrd2 A G 19: 42,040,105 T67A possibly damaging Het
Anln A T 9: 22,376,308 C232* probably null Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Dcdc2a T C 13: 25,205,457 V456A probably benign Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Kidins220 G A 12: 25,052,813 R1238Q probably damaging Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Lzts1 A G 8: 69,140,872 S28P probably benign Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Muc16 T A 9: 18,497,797 N198Y probably damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Olfr477 G T 7: 107,990,413 G16V probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Prl8a8 T C 13: 27,510,480 Y108C probably damaging Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Rps24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Rps24 APN 14 24491755 missense probably benign
R1209:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1317:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1363:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1365:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1393:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1427:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1429:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1771:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R1776:Rps24 UTSW 14 24491762 missense probably damaging 1.00
R2916:Rps24 UTSW 14 24491941 missense probably benign 0.02
R4837:Rps24 UTSW 14 24491787 missense possibly damaging 0.93
R6249:Rps24 UTSW 14 24493462 missense possibly damaging 0.92
R6386:Rps24 UTSW 14 24492048 missense possibly damaging 0.79
R7316:Rps24 UTSW 14 24490689 unclassified probably benign
V7732:Rps24 UTSW 14 24491762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTGGATCCAATTCAGGCCAG -3'
(R):5'- AGCTCCACAGGGGTTTCCATAG -3'

Sequencing Primer
(F):5'- ATTCAGGCCAGCCAGAGC -3'
(R):5'- ACAGGGGTTTCCATAGCCGAG -3'
Posted On2017-10-10