Incidental Mutation 'R6146:Ankrd2'
ID488918
Institutional Source Beutler Lab
Gene Symbol Ankrd2
Ensembl Gene ENSMUSG00000025172
Gene Nameankyrin repeat domain 2 (stretch responsive muscle)
SynonymsmArpp, Arpp
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6146 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location42036038-42045110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42040105 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 67 (T67A)
Ref Sequence ENSEMBL: ENSMUSP00000026172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026172
AA Change: T67A

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026172
Gene: ENSMUSG00000025172
AA Change: T67A

DomainStartEndE-ValueType
low complexity region 104 111 N/A INTRINSIC
ANK 149 178 5.24e-4 SMART
ANK 182 211 5.79e-6 SMART
ANK 215 244 1.33e-5 SMART
ANK 248 277 3.18e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the muscle ankyrin repeat protein (MARP) family. A similar gene in rodents is a component of a muscle stress response pathway and plays a role in the stretch-response associated with slow muscle function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and free of cardiac defects but exhibit altered inflammatory responses and are prone to skeletal muscle fiber-type switching of slow fibers toward a faster phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Anln A T 9: 22,376,308 C232* probably null Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Dcdc2a T C 13: 25,205,457 V456A probably benign Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Kidins220 G A 12: 25,052,813 R1238Q probably damaging Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Lzts1 A G 8: 69,140,872 S28P probably benign Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Muc16 T A 9: 18,497,797 N198Y probably damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Olfr477 G T 7: 107,990,413 G16V probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Prl8a8 T C 13: 27,510,480 Y108C probably damaging Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Rps24 A T 14: 24,490,735 probably null Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Ankrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Ankrd2 APN 19 42039910 missense probably damaging 0.97
IGL03088:Ankrd2 APN 19 42041985 missense probably null 0.01
IGL03050:Ankrd2 UTSW 19 42040094 missense probably damaging 1.00
R0133:Ankrd2 UTSW 19 42044071 missense probably benign 0.01
R0930:Ankrd2 UTSW 19 42043853 critical splice donor site probably null
R2135:Ankrd2 UTSW 19 42044059 missense probably damaging 1.00
R2204:Ankrd2 UTSW 19 42044119 missense probably damaging 0.98
R2205:Ankrd2 UTSW 19 42044119 missense probably damaging 0.98
R4529:Ankrd2 UTSW 19 42043801 missense probably benign 0.05
R4833:Ankrd2 UTSW 19 42043857 splice site probably null
R5112:Ankrd2 UTSW 19 42039887 missense possibly damaging 0.71
R6005:Ankrd2 UTSW 19 42040115 missense probably damaging 1.00
R7382:Ankrd2 UTSW 19 42044972 missense
R7556:Ankrd2 UTSW 19 42040400 missense
X0063:Ankrd2 UTSW 19 42042403 missense probably benign 0.01
Z1177:Ankrd2 UTSW 19 42040159 missense
Z1177:Ankrd2 UTSW 19 42044999 missense
Predicted Primers PCR Primer
(F):5'- CAGAGTCCTGCTTTACAAAAGG -3'
(R):5'- TCTGCAGGTAGAACATCCGC -3'

Sequencing Primer
(F):5'- GAGTCCTGCTTTACAAAAGGTTAAGG -3'
(R):5'- ATAAAGGGAGCTTCCGGGCC -3'
Posted On2017-10-10