Incidental Mutation 'R6147:Camsap2'
ID488922
Institutional Source Beutler Lab
Gene Symbol Camsap2
Ensembl Gene ENSMUSG00000041570
Gene Namecalmodulin regulated spectrin-associated protein family, member 2
Synonyms1600013L13Rik, Camsap1l1, 4930541M15Rik
MMRRC Submission 044294-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R6147 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location136268123-136346104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136345400 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 13 (T13M)
Ref Sequence ENSEMBL: ENSMUSP00000142166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048309] [ENSMUST00000192001] [ENSMUST00000192314]
Predicted Effect probably damaging
Transcript: ENSMUST00000048309
AA Change: T13M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041920
Gene: ENSMUSG00000041570
AA Change: T13M

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 239 322 3.6e-37 PFAM
low complexity region 379 388 N/A INTRINSIC
low complexity region 397 410 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
low complexity region 671 690 N/A INTRINSIC
low complexity region 706 711 N/A INTRINSIC
Pfam:CAMSAP_CC1 738 795 7.3e-28 PFAM
coiled coil region 878 916 N/A INTRINSIC
low complexity region 922 929 N/A INTRINSIC
low complexity region 943 956 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
coiled coil region 1155 1227 N/A INTRINSIC
low complexity region 1242 1256 N/A INTRINSIC
CAMSAP_CKK 1337 1466 1.59e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192001
AA Change: T13M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142166
Gene: ENSMUSG00000041570
AA Change: T13M

DomainStartEndE-ValueType
Pfam:CH 178 324 1.1e-37 PFAM
Pfam:CAMSAP_CH 222 305 2.7e-36 PFAM
low complexity region 362 371 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
low complexity region 654 673 N/A INTRINSIC
low complexity region 689 694 N/A INTRINSIC
coiled coil region 729 767 N/A INTRINSIC
coiled coil region 861 899 N/A INTRINSIC
low complexity region 905 912 N/A INTRINSIC
low complexity region 926 939 N/A INTRINSIC
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
coiled coil region 1138 1210 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
CAMSAP_CKK 1320 1449 1.59e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192314
AA Change: T13M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142299
Gene: ENSMUSG00000041570
AA Change: T13M

DomainStartEndE-ValueType
Pfam:CH 178 335 1.2e-35 PFAM
Pfam:CAMSAP_CH 233 316 3.2e-34 PFAM
low complexity region 373 382 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 477 485 N/A INTRINSIC
low complexity region 665 684 N/A INTRINSIC
low complexity region 700 705 N/A INTRINSIC
coiled coil region 740 778 N/A INTRINSIC
coiled coil region 872 910 N/A INTRINSIC
low complexity region 916 923 N/A INTRINSIC
low complexity region 937 950 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1087 1101 N/A INTRINSIC
coiled coil region 1149 1221 N/A INTRINSIC
low complexity region 1236 1250 N/A INTRINSIC
CAMSAP_CKK 1331 1460 1.2e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194730
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.1%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,379,308 Y168C probably damaging Het
Acmsd C T 1: 127,729,420 probably benign Het
Acsf3 T A 8: 122,781,474 D236E probably damaging Het
Aqp1 G T 6: 55,336,610 E40D probably benign Het
Arfgef2 A G 2: 166,871,495 D1272G probably damaging Het
Arfip1 A G 3: 84,529,178 V97A probably benign Het
Atp6v1b2 T A 8: 69,102,482 Y165* probably null Het
BC051142 T C 17: 34,418,923 S31P possibly damaging Het
Bclaf1 T A 10: 20,323,425 D189E possibly damaging Het
Cntn5 T A 9: 10,012,889 Y297F probably damaging Het
Cntnap5b G A 1: 100,050,781 C174Y probably damaging Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Comtd1 C A 14: 21,848,815 A20S probably damaging Het
Cspg4 A T 9: 56,888,772 R1264W probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dlgap2 T A 8: 14,727,294 C180S probably benign Het
Ednra C T 8: 77,667,322 probably benign Het
Ephb6 A T 6: 41,616,781 S533C probably damaging Het
Fndc1 A T 17: 7,753,762 probably null Het
Gif G A 19: 11,747,572 probably benign Het
Gm11639 T C 11: 104,967,740 V3875A unknown Het
Gm12185 A G 11: 48,915,890 I158T probably benign Het
Gm14325 A T 2: 177,832,807 C161S probably damaging Het
Gm17677 A T 9: 35,742,110 Y70F possibly damaging Het
Gm17677 A G 9: 35,742,232 T111A possibly damaging Het
Ighv9-1 T A 12: 114,094,220 Q20L probably damaging Het
Khnyn G C 14: 55,887,603 S438T probably damaging Het
Krt9 T C 11: 100,188,839 S576G unknown Het
Lrriq4 A T 3: 30,659,079 N443I probably damaging Het
Luzp1 A G 4: 136,541,063 Y199C probably damaging Het
Map2k3 T A 11: 60,949,950 Y268* probably null Het
Men1 T A 19: 6,337,242 D248E probably damaging Het
Mfsd4b2 A T 10: 39,921,577 C261S probably benign Het
Mpeg1 T G 19: 12,462,894 I572S probably damaging Het
Mrgprb2 A G 7: 48,552,365 V204A possibly damaging Het
Mycbp2 A T 14: 103,155,509 C805* probably null Het
Nphs2 A T 1: 156,318,726 K91* probably null Het
Obox3 A G 7: 15,626,001 S248P probably damaging Het
Olfr1054 A T 2: 86,332,500 N285K probably damaging Het
Olfr109 T C 17: 37,466,539 I111T probably benign Het
Olfr1152 C T 2: 87,868,717 T242I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pan3 T C 5: 147,548,283 probably benign Het
Pcdhb5 T A 18: 37,320,726 L53Q probably damaging Het
Pcdhb9 G T 18: 37,402,441 R496L possibly damaging Het
Peg10 C T 6: 4,754,499 probably benign Het
Plce1 A G 19: 38,702,037 K722E probably damaging Het
Plch1 A G 3: 63,722,881 S489P probably damaging Het
Plekhg3 T C 12: 76,565,211 V362A probably damaging Het
Radil G A 5: 142,497,940 H264Y probably benign Het
Ranbp2 C A 10: 58,479,428 T1990K probably damaging Het
Rnf207 T C 4: 152,315,655 D192G probably damaging Het
Ryr1 A T 7: 29,085,914 F1784Y possibly damaging Het
Set T A 2: 30,066,824 S2T probably benign Het
Slc26a2 T A 18: 61,201,685 Y232F probably damaging Het
Sntb1 T A 15: 55,648,010 M393L probably benign Het
Stx16 A G 2: 174,090,687 T18A probably damaging Het
Stxbp5 A T 10: 9,808,472 S585T possibly damaging Het
Sult2a7 T C 7: 14,465,163 E313G probably damaging Het
Tbck A G 3: 132,694,446 K86R probably benign Het
Tom1 A T 8: 75,054,692 Q255L possibly damaging Het
Trbv4 A G 6: 41,059,703 Y54C probably damaging Het
Trim34a A T 7: 104,261,191 Q400L probably damaging Het
Trim42 G T 9: 97,363,329 H473N probably benign Het
Tshr T A 12: 91,538,235 M649K possibly damaging Het
Vmn2r11 C T 5: 109,054,834 V126M probably benign Het
Vps13b T A 15: 35,930,031 H3971Q probably benign Het
Wdr75 T A 1: 45,819,538 N622K probably benign Het
Wdr93 A T 7: 79,758,497 Q242L probably benign Het
Other mutations in Camsap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Camsap2 APN 1 136297790 missense probably benign 0.23
IGL02727:Camsap2 APN 1 136304312 missense probably benign
IGL02803:Camsap2 APN 1 136281123 missense probably damaging 1.00
IGL03037:Camsap2 APN 1 136274857 missense probably damaging 1.00
IGL03124:Camsap2 APN 1 136274799 critical splice donor site probably null
IGL03189:Camsap2 APN 1 136281662 missense probably damaging 1.00
IGL03297:Camsap2 APN 1 136297801 missense probably benign
IGL03347:Camsap2 APN 1 136280986 missense possibly damaging 0.52
ANU23:Camsap2 UTSW 1 136297790 missense probably benign 0.23
PIT4366001:Camsap2 UTSW 1 136280317 missense
R0001:Camsap2 UTSW 1 136282888 unclassified probably benign
R0037:Camsap2 UTSW 1 136281892 missense probably damaging 1.00
R0140:Camsap2 UTSW 1 136280382 missense probably benign
R0194:Camsap2 UTSW 1 136292948 nonsense probably null
R0206:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0208:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0517:Camsap2 UTSW 1 136293388 missense possibly damaging 0.95
R0648:Camsap2 UTSW 1 136304319 missense probably damaging 0.96
R0735:Camsap2 UTSW 1 136292888 missense probably damaging 1.00
R0790:Camsap2 UTSW 1 136273737 splice site probably benign
R0880:Camsap2 UTSW 1 136280970 missense probably benign 0.08
R1559:Camsap2 UTSW 1 136282094 missense probably benign 0.02
R1728:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1729:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1730:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1739:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1762:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1783:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1784:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1785:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1823:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1824:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1997:Camsap2 UTSW 1 136271545 missense probably damaging 1.00
R2010:Camsap2 UTSW 1 136274868 missense probably damaging 1.00
R2237:Camsap2 UTSW 1 136345331 missense probably damaging 1.00
R2923:Camsap2 UTSW 1 136280809 missense possibly damaging 0.95
R4275:Camsap2 UTSW 1 136270876 missense probably benign 0.01
R4371:Camsap2 UTSW 1 136287963 missense probably damaging 1.00
R4976:Camsap2 UTSW 1 136304386 missense probably damaging 1.00
R5227:Camsap2 UTSW 1 136274891 intron probably benign
R5513:Camsap2 UTSW 1 136280863 missense probably benign 0.23
R5755:Camsap2 UTSW 1 136282327 missense probably damaging 1.00
R5834:Camsap2 UTSW 1 136280388 missense probably benign
R5966:Camsap2 UTSW 1 136276592 missense probably damaging 1.00
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6111:Camsap2 UTSW 1 136281298 missense probably benign
R6284:Camsap2 UTSW 1 136304437 missense possibly damaging 0.63
R6293:Camsap2 UTSW 1 136287920 missense probably damaging 1.00
R6306:Camsap2 UTSW 1 136281199 missense probably benign
R6403:Camsap2 UTSW 1 136280800 nonsense probably null
R6410:Camsap2 UTSW 1 136345444 start gained probably benign
R6943:Camsap2 UTSW 1 136304449 missense probably damaging 1.00
R7268:Camsap2 UTSW 1 136273745 splice site probably null
R7448:Camsap2 UTSW 1 136270906 missense
R7472:Camsap2 UTSW 1 136281393 missense probably damaging 0.96
R7478:Camsap2 UTSW 1 136270940 missense
R7515:Camsap2 UTSW 1 136345370 missense probably damaging 0.99
R7691:Camsap2 UTSW 1 136293004 missense probably damaging 0.99
R7800:Camsap2 UTSW 1 136281901 missense probably damaging 0.99
R8040:Camsap2 UTSW 1 136281247 missense
R8188:Camsap2 UTSW 1 136297394 splice site probably null
R8238:Camsap2 UTSW 1 136294026 missense probably benign 0.03
R8258:Camsap2 UTSW 1 136280339 missense probably benign 0.00
R8259:Camsap2 UTSW 1 136280339 missense probably benign 0.00
R8537:Camsap2 UTSW 1 136277205 missense probably damaging 0.99
X0018:Camsap2 UTSW 1 136276575 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACCAAACCTGCCTTCTTTC -3'
(R):5'- CGAGCACAGCTGAGCTTTTC -3'

Sequencing Primer
(F):5'- CCTGTACCGGAAGATACACATGG -3'
(R):5'- ACAGCTGAGCTTTTCCGTGC -3'
Posted On2017-10-10