Mutagenetix > Incidental Mutations

Incidental Mutation 'R6147:Cntrl'

488925

Institutional Source

Beutler Lab

Gene Symbol

Cntrl

Ensembl Gene

ENSMUSG00000057110

Gene Name

centriolin

Synonyms

6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1

MMRRC Submission

044294-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.902) question?

Stock #

R6147 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

35109492-35178822 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 35165733 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1213 (D1213A)

Ref Sequence

ENSEMBL: ENSMUSP00000108660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113037] [ENSMUST00000124081] [ENSMUST00000156933]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028237
AA Change: D1767A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: D1767A

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
LRR	146	167	2.54e1	SMART
LRR	168	190	3.24e0	SMART
LRR	192	214	7.16e0	SMART
Blast:LRR	217	239	8e-6	BLAST
low complexity region	275	292	N/A	INTRINSIC
coiled coil region	437	800	N/A	INTRINSIC
coiled coil region	858	971	N/A	INTRINSIC
low complexity region	975	995	N/A	INTRINSIC
coiled coil region	998	1102	N/A	INTRINSIC
internal_repeat_1	1119	1132	1.95e-5	PROSPERO
low complexity region	1153	1161	N/A	INTRINSIC
low complexity region	1268	1301	N/A	INTRINSIC
coiled coil region	1320	1629	N/A	INTRINSIC
coiled coil region	1661	2155	N/A	INTRINSIC
low complexity region	2193	2208	N/A	INTRINSIC
internal_repeat_1	2252	2265	1.95e-5	PROSPERO
low complexity region	2289	2307	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113032
AA Change: D1766A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: D1766A

Domain	Start	End	E-Value	Type
low complexity region	20	53	N/A	INTRINSIC
coiled coil region	72	381	N/A	INTRINSIC
coiled coil region	413	907	N/A	INTRINSIC
low complexity region	945	960	N/A	INTRINSIC
coiled coil region	989	1011	N/A	INTRINSIC
low complexity region	1041	1059	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113037
AA Change: D1213A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110
AA Change: D1213A

Domain	Start	End	E-Value	Type
coiled coil region	1	247	N/A	INTRINSIC
internal_repeat_3	261	278	5.34e-5	PROSPERO
coiled coil region	305	548	N/A	INTRINSIC
internal_repeat_1	565	578	1.42e-6	PROSPERO
internal_repeat_2	567	595	2.58e-5	PROSPERO
low complexity region	599	607	N/A	INTRINSIC
internal_repeat_2	625	652	2.58e-5	PROSPERO
low complexity region	714	747	N/A	INTRINSIC
coiled coil region	766	1075	N/A	INTRINSIC
internal_repeat_3	1094	1111	5.34e-5	PROSPERO
low complexity region	1183	1223	N/A	INTRINSIC
low complexity region	1343	1355	N/A	INTRINSIC
low complexity region	1365	1387	N/A	INTRINSIC
low complexity region	1399	1414	N/A	INTRINSIC
low complexity region	1420	1431	N/A	INTRINSIC
low complexity region	1639	1654	N/A	INTRINSIC
internal_repeat_1	1698	1711	1.42e-6	PROSPERO
low complexity region	1735	1753	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124081

SMART Domains

Protein: ENSMUSP00000143087
Gene: ENSMUSG00000057110

Domain	Start	End	E-Value	Type
coiled coil region	1	51	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130457

Predicted Effect

possibly damaging
Transcript: ENSMUST00000156933
AA Change: D1767A

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: D1767A

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
LRR	146	167	2.54e1	SMART
LRR	168	190	3.24e0	SMART
LRR	192	214	7.16e0	SMART
Blast:LRR	217	239	7e-6	BLAST
low complexity region	275	292	N/A	INTRINSIC
coiled coil region	437	800	N/A	INTRINSIC
coiled coil region	858	971	N/A	INTRINSIC
low complexity region	975	995	N/A	INTRINSIC
coiled coil region	998	1102	N/A	INTRINSIC
internal_repeat_1	1119	1132	1.65e-5	PROSPERO
low complexity region	1153	1161	N/A	INTRINSIC
low complexity region	1268	1301	N/A	INTRINSIC
coiled coil region	1320	1629	N/A	INTRINSIC
coiled coil region	1661	2155	N/A	INTRINSIC
low complexity region	2193	2208	N/A	INTRINSIC
internal_repeat_1	2252	2265	1.65e-5	PROSPERO
low complexity region	2289	2307	N/A	INTRINSIC

Meta Mutation Damage Score

0.0772

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 97.1%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,379,308	Y168C	probably damaging	Het
Acmsd	C	T	1: 127,729,420		probably benign	Het
Acsf3	T	A	8: 122,781,474	D236E	probably damaging	Het
Aqp1	G	T	6: 55,336,610	E40D	probably benign	Het
Arfgef2	A	G	2: 166,871,495	D1272G	probably damaging	Het
Arfip1	A	G	3: 84,529,178	V97A	probably benign	Het
Atp6v1b2	T	A	8: 69,102,482	Y165*	probably null	Het
BC051142	T	C	17: 34,418,923	S31P	possibly damaging	Het
Bclaf1	T	A	10: 20,323,425	D189E	possibly damaging	Het
Camsap2	G	A	1: 136,345,400	T13M	probably damaging	Het
Cntn5	T	A	9: 10,012,889	Y297F	probably damaging	Het
Cntnap5b	G	A	1: 100,050,781	C174Y	probably damaging	Het
Comtd1	C	A	14: 21,848,815	A20S	probably damaging	Het
Cspg4	A	T	9: 56,888,772	R1264W	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dlgap2	T	A	8: 14,727,294	C180S	probably benign	Het
Ednra	C	T	8: 77,667,322		probably benign	Het
Ephb6	A	T	6: 41,616,781	S533C	probably damaging	Het
Fndc1	A	T	17: 7,753,762		probably null	Het
Gif	G	A	19: 11,747,572		probably benign	Het
Gm11639	T	C	11: 104,967,740	V3875A	unknown	Het
Gm12185	A	G	11: 48,915,890	I158T	probably benign	Het
Gm14325	A	T	2: 177,832,807	C161S	probably damaging	Het
Gm17677	A	T	9: 35,742,110	Y70F	possibly damaging	Het
Gm17677	A	G	9: 35,742,232	T111A	possibly damaging	Het
Ighv9-1	T	A	12: 114,094,220	Q20L	probably damaging	Het
Khnyn	G	C	14: 55,887,603	S438T	probably damaging	Het
Krt9	T	C	11: 100,188,839	S576G	unknown	Het
Lrriq4	A	T	3: 30,659,079	N443I	probably damaging	Het
Luzp1	A	G	4: 136,541,063	Y199C	probably damaging	Het
Map2k3	T	A	11: 60,949,950	Y268*	probably null	Het
Men1	T	A	19: 6,337,242	D248E	probably damaging	Het
Mfsd4b2	A	T	10: 39,921,577	C261S	probably benign	Het
Mpeg1	T	G	19: 12,462,894	I572S	probably damaging	Het
Mrgprb2	A	G	7: 48,552,365	V204A	possibly damaging	Het
Mycbp2	A	T	14: 103,155,509	C805*	probably null	Het
Nphs2	A	T	1: 156,318,726	K91*	probably null	Het
Obox3	A	G	7: 15,626,001	S248P	probably damaging	Het
Olfr1054	A	T	2: 86,332,500	N285K	probably damaging	Het
Olfr109	T	C	17: 37,466,539	I111T	probably benign	Het
Olfr1152	C	T	2: 87,868,717	T242I	probably benign	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pan3	T	C	5: 147,548,283		probably benign	Het
Pcdhb5	T	A	18: 37,320,726	L53Q	probably damaging	Het
Pcdhb9	G	T	18: 37,402,441	R496L	possibly damaging	Het
Peg10	C	T	6: 4,754,499		probably benign	Het
Plce1	A	G	19: 38,702,037	K722E	probably damaging	Het
Plch1	A	G	3: 63,722,881	S489P	probably damaging	Het
Plekhg3	T	C	12: 76,565,211	V362A	probably damaging	Het
Radil	G	A	5: 142,497,940	H264Y	probably benign	Het
Ranbp2	C	A	10: 58,479,428	T1990K	probably damaging	Het
Rnf207	T	C	4: 152,315,655	D192G	probably damaging	Het
Ryr1	A	T	7: 29,085,914	F1784Y	possibly damaging	Het
Set	T	A	2: 30,066,824	S2T	probably benign	Het
Slc26a2	T	A	18: 61,201,685	Y232F	probably damaging	Het
Sntb1	T	A	15: 55,648,010	M393L	probably benign	Het
Stx16	A	G	2: 174,090,687	T18A	probably damaging	Het
Stxbp5	A	T	10: 9,808,472	S585T	possibly damaging	Het
Sult2a7	T	C	7: 14,465,163	E313G	probably damaging	Het
Tbck	A	G	3: 132,694,446	K86R	probably benign	Het
Tom1	A	T	8: 75,054,692	Q255L	possibly damaging	Het
Trbv4	A	G	6: 41,059,703	Y54C	probably damaging	Het
Trim34a	A	T	7: 104,261,191	Q400L	probably damaging	Het
Trim42	G	T	9: 97,363,329	H473N	probably benign	Het
Tshr	T	A	12: 91,538,235	M649K	possibly damaging	Het
Vmn2r11	C	T	5: 109,054,834	V126M	probably benign	Het
Vps13b	T	A	15: 35,930,031	H3971Q	probably benign	Het
Wdr75	T	A	1: 45,819,538	N622K	probably benign	Het
Wdr93	A	T	7: 79,758,497	Q242L	probably benign	Het

Other mutations in Cntrl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Cntrl	APN	2	35137814	splice site	probably benign
IGL00478:Cntrl	APN	2	35160601	missense	probably damaging	0.98
IGL01460:Cntrl	APN	2	35165844	missense	probably benign	0.04
IGL01556:Cntrl	APN	2	35173059	missense	probably benign	0.19
IGL02155:Cntrl	APN	2	35160238	splice site	probably benign
IGL02419:Cntrl	APN	2	35134043	missense	probably damaging	0.97
PIT4480001:Cntrl	UTSW	2	35155428	missense	probably damaging	0.96
R0179:Cntrl	UTSW	2	35167859	missense	probably benign	0.00
R0276:Cntrl	UTSW	2	35151732	missense	possibly damaging	0.62
R0471:Cntrl	UTSW	2	35127380	missense	probably benign	0.41
R0755:Cntrl	UTSW	2	35145139	missense	probably damaging	1.00
R0763:Cntrl	UTSW	2	35171066	missense	probably benign
R0781:Cntrl	UTSW	2	35160627	missense	possibly damaging	0.66
R0791:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R0792:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R0801:Cntrl	UTSW	2	35175095	splice site	probably benign
R1067:Cntrl	UTSW	2	35149022	unclassified	probably benign
R1110:Cntrl	UTSW	2	35160627	missense	possibly damaging	0.66
R1117:Cntrl	UTSW	2	35127973	missense	probably damaging	1.00
R1457:Cntrl	UTSW	2	35122756	missense	probably benign	0.00
R1472:Cntrl	UTSW	2	35169317	critical splice donor site	probably null
R1522:Cntrl	UTSW	2	35155279	missense	possibly damaging	0.83
R1702:Cntrl	UTSW	2	35171836	critical splice acceptor site	probably null
R1762:Cntrl	UTSW	2	35122806	frame shift	probably null
R1785:Cntrl	UTSW	2	35122806	frame shift	probably null
R1786:Cntrl	UTSW	2	35122806	frame shift	probably null
R1812:Cntrl	UTSW	2	35149469	missense	probably damaging	0.97
R1854:Cntrl	UTSW	2	35122684	missense	probably damaging	1.00
R1863:Cntrl	UTSW	2	35118119	missense	possibly damaging	0.93
R1868:Cntrl	UTSW	2	35129815	missense	probably benign	0.03
R1914:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R1915:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R2049:Cntrl	UTSW	2	35122806	frame shift	probably null
R2118:Cntrl	UTSW	2	35161965	missense	probably benign	0.31
R2140:Cntrl	UTSW	2	35122806	frame shift	probably null
R2142:Cntrl	UTSW	2	35122806	frame shift	probably null
R2203:Cntrl	UTSW	2	35143737	missense	possibly damaging	0.84
R2300:Cntrl	UTSW	2	35127513	missense	probably benign	0.00
R2349:Cntrl	UTSW	2	35176251	missense	probably benign	0.18
R2374:Cntrl	UTSW	2	35153276	missense	possibly damaging	0.46
R3429:Cntrl	UTSW	2	35145100	missense	probably damaging	1.00
R3890:Cntrl	UTSW	2	35170480	missense	probably benign	0.02
R3911:Cntrl	UTSW	2	35120049	missense	probably damaging	1.00
R3922:Cntrl	UTSW	2	35129739	missense	probably damaging	0.98
R4081:Cntrl	UTSW	2	35161926	splice site	probably benign
R4081:Cntrl	UTSW	2	35175125	missense	probably damaging	1.00
R4516:Cntrl	UTSW	2	35127981	missense	probably benign	0.00
R4518:Cntrl	UTSW	2	35148974	missense	probably damaging	1.00
R4519:Cntrl	UTSW	2	35173111	missense	probably damaging	1.00
R4646:Cntrl	UTSW	2	35149461	missense	probably damaging	0.99
R4753:Cntrl	UTSW	2	35153439	missense	possibly damaging	0.90
R4763:Cntrl	UTSW	2	35175551	missense	probably damaging	1.00
R4916:Cntrl	UTSW	2	35165682	missense	probably benign	0.42
R5168:Cntrl	UTSW	2	35157655	missense	probably damaging	1.00
R5291:Cntrl	UTSW	2	35134060	missense	probably damaging	1.00
R5356:Cntrl	UTSW	2	35148899	nonsense	probably null
R5774:Cntrl	UTSW	2	35162861	missense	probably benign	0.15
R5947:Cntrl	UTSW	2	35116679	missense	probably damaging	1.00
R6144:Cntrl	UTSW	2	35165733	missense	possibly damaging	0.93
R6214:Cntrl	UTSW	2	35129634	missense	probably benign	0.10
R6267:Cntrl	UTSW	2	35129793	missense	probably damaging	1.00
R6332:Cntrl	UTSW	2	35128024	missense	possibly damaging	0.78
R6445:Cntrl	UTSW	2	35162848	missense	probably benign	0.05
R6487:Cntrl	UTSW	2	35122682	missense	possibly damaging	0.89
R6497:Cntrl	UTSW	2	35135572	missense	possibly damaging	0.66
R6782:Cntrl	UTSW	2	35170646	missense	possibly damaging	0.75
R6815:Cntrl	UTSW	2	35149491	missense	probably damaging	1.00
R6853:Cntrl	UTSW	2	35129821	missense	possibly damaging	0.87
R6858:Cntrl	UTSW	2	35162095	critical splice donor site	probably null
R6965:Cntrl	UTSW	2	35162833	missense	probably benign	0.20
R6970:Cntrl	UTSW	2	35118137	missense	probably benign
R7085:Cntrl	UTSW	2	35165792	missense	probably benign	0.00
R7150:Cntrl	UTSW	2	35165445	critical splice acceptor site	probably null
R7213:Cntrl	UTSW	2	35135680	missense	possibly damaging	0.95
R7221:Cntrl	UTSW	2	35151857	missense	possibly damaging	0.46
R7389:Cntrl	UTSW	2	35127517	missense	probably benign	0.01
R7414:Cntrl	UTSW	2	35165467	missense	probably benign	0.02
R7427:Cntrl	UTSW	2	35170534	missense	probably benign	0.00
R7428:Cntrl	UTSW	2	35170534	missense	probably benign	0.00
R7453:Cntrl	UTSW	2	35155409	missense	possibly damaging	0.89
R7747:Cntrl	UTSW	2	35116798	missense	probably damaging	1.00
R7753:Cntrl	UTSW	2	35111679	missense	probably damaging	1.00
R7811:Cntrl	UTSW	2	35162861	missense	probably benign	0.00
R7882:Cntrl	UTSW	2	35170580	missense	probably benign	0.41
R7919:Cntrl	UTSW	2	35127401	missense	probably benign
R8314:Cntrl	UTSW	2	35175143	missense	probably benign	0.00
R8332:Cntrl	UTSW	2	35126025	missense	probably damaging	1.00
RF007:Cntrl	UTSW	2	35170500	missense	probably benign
RF016:Cntrl	UTSW	2	35119986	missense	probably benign
RF017:Cntrl	UTSW	2	35175189	missense	probably damaging	0.96
X0024:Cntrl	UTSW	2	35147296	missense	probably damaging	1.00
X0026:Cntrl	UTSW	2	35149516	missense	probably damaging	1.00
X0027:Cntrl	UTSW	2	35157768	missense	probably damaging	1.00
X0027:Cntrl	UTSW	2	35165682	missense	probably benign	0.08
X0028:Cntrl	UTSW	2	35147344	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCTCCAGCATGACCAGAAGG -3'
(R):5'- GCATCTCTCTGTTCTCATGGTTG -3'

Sequencing Primer
(F):5'- CAGGTGGACGTGCTGGAG -3'
(R):5'- ATGGTTGCCCCCATGTCTC -3'

Posted On

2017-10-10