Incidental Mutation 'R0526:Olfr1093'
ID48893
Institutional Source Beutler Lab
Gene Symbol Olfr1093
Ensembl Gene ENSMUSG00000047969
Gene Nameolfactory receptor 1093
SynonymsGA_x6K02T2Q125-48278396-48279364, MOR179-6
MMRRC Submission 038719-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R0526 (G1)
Quality Score221
Status Not validated
Chromosome2
Chromosomal Location86782479-86787616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86786347 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 206 (T206S)
Ref Sequence ENSEMBL: ENSMUSP00000151453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055273] [ENSMUST00000213354] [ENSMUST00000219561]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055273
AA Change: T206S

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049733
Gene: ENSMUSG00000047969
AA Change: T206S

DomainStartEndE-ValueType
Pfam:7tm_4 43 319 2.4e-49 PFAM
Pfam:7tm_1 53 302 1.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213354
AA Change: T206S

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219561
AA Change: T206S

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,455,224 N230I possibly damaging Het
4933427D14Rik G T 11: 72,169,783 Q687K probably damaging Het
Actrt2 A G 4: 154,667,412 L89P probably damaging Het
Adamts1 A C 16: 85,802,372 S113R probably benign Het
Agxt2 G T 15: 10,373,862 C118F probably damaging Het
Akap8 G A 17: 32,317,292 T49I probably benign Het
Alk A T 17: 71,869,753 W1519R probably damaging Het
Atf7ip T A 6: 136,559,805 F12Y probably damaging Het
Atp13a5 A G 16: 29,348,740 C131R probably damaging Het
Atp8b4 A G 2: 126,427,363 L168P probably damaging Het
Blm G T 7: 80,505,893 S346* probably null Het
Ccnt2 T G 1: 127,799,445 C199G probably damaging Het
Cd151 A T 7: 141,470,591 H219L probably damaging Het
Cd200r2 A T 16: 44,915,047 R248S probably damaging Het
Cdh3 A G 8: 106,555,446 D822G possibly damaging Het
Clec4b1 T C 6: 123,069,770 probably null Het
Cluh C A 11: 74,665,986 L951I probably benign Het
Cog7 A T 7: 121,963,271 probably null Het
Col25a1 C A 3: 130,476,394 P197Q probably damaging Het
Csde1 T A 3: 103,056,426 S636R possibly damaging Het
Ect2l C A 10: 18,199,940 C66F possibly damaging Het
Elac2 T C 11: 64,999,436 M671T probably benign Het
Evi5 T C 5: 107,821,748 N143S probably benign Het
Ext2 A G 2: 93,806,085 V228A probably damaging Het
Fbxo38 A G 18: 62,505,980 Y1084H probably damaging Het
Fcgr4 T A 1: 171,029,191 L209Q probably damaging Het
Fgd3 C T 13: 49,296,524 S83N probably benign Het
Gigyf2 T A 1: 87,421,493 M664K probably benign Het
Gm38394 T C 1: 133,658,734 I288M probably damaging Het
Il27ra A T 8: 84,039,499 S219T probably benign Het
Kif15 T C 9: 122,997,797 V800A probably damaging Het
Lmo7 T A 14: 101,900,560 D666E probably damaging Het
Lrp5 T C 19: 3,628,295 D520G probably damaging Het
Lrriq3 T A 3: 155,188,297 M545K probably benign Het
Lsm5 T A 6: 56,703,325 D44V probably damaging Het
Man1c1 G T 4: 134,569,068 Y430* probably null Het
Map4 T A 9: 110,037,278 probably null Het
Megf6 A G 4: 154,258,941 K561R probably benign Het
Myo1e T C 9: 70,322,398 Y173H probably damaging Het
Myo6 T A 9: 80,283,541 S791R possibly damaging Het
Nol11 C A 11: 107,184,771 E144* probably null Het
Ntng2 C T 2: 29,197,062 R416Q probably damaging Het
Nxpe3 T A 16: 55,866,517 I43F possibly damaging Het
Olfr1284 T A 2: 111,379,492 V164E possibly damaging Het
Pkd1l2 T C 8: 117,082,260 I64V probably damaging Het
Prf1 G A 10: 61,300,254 R103H probably benign Het
Rest A G 5: 77,281,027 D431G probably damaging Het
Serpina10 A T 12: 103,616,868 L439Q probably damaging Het
Sgk3 T G 1: 9,881,579 V176G probably damaging Het
Slc19a3 A G 1: 83,022,733 S188P probably damaging Het
Sorbs1 A G 19: 40,349,948 I336T probably damaging Het
Ssfa2 A G 2: 79,657,346 D591G probably benign Het
Strip1 C T 3: 107,620,039 probably null Het
Syt4 T C 18: 31,443,746 E185G possibly damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tgfbr3l G T 8: 4,249,439 R74L possibly damaging Het
Thoc7 A G 14: 13,949,282 M194T probably benign Het
Thsd7b T C 1: 129,951,392 Y989H probably damaging Het
Tmem156 C T 5: 65,075,818 V134I probably benign Het
Tnks A T 8: 34,853,303 V738E probably benign Het
Trpm6 A T 19: 18,792,876 I342F probably damaging Het
Vmn2r69 A T 7: 85,411,503 V291D probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Wnk1 T C 6: 119,951,992 T1292A probably damaging Het
Yes1 T A 5: 32,655,240 C285S probably benign Het
Zbtb49 T C 5: 38,213,919 N206S probably benign Het
Other mutations in Olfr1093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Olfr1093 APN 2 86786150 missense probably benign 0.19
IGL02337:Olfr1093 APN 2 86786174 missense probably damaging 1.00
IGL02734:Olfr1093 APN 2 86786368 missense probably benign 0.13
R0379:Olfr1093 UTSW 2 86785735 missense probably benign
R3959:Olfr1093 UTSW 2 86785996 missense probably benign 0.04
R5635:Olfr1093 UTSW 2 86785726 unclassified probably null
R5951:Olfr1093 UTSW 2 86786227 missense probably benign
R6932:Olfr1093 UTSW 2 86786155 missense probably damaging 1.00
R7289:Olfr1093 UTSW 2 86786690 missense probably benign
R7432:Olfr1093 UTSW 2 86786221 nonsense probably null
Z1088:Olfr1093 UTSW 2 86786473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGCTTTCTCCTGGCAGCAATG -3'
(R):5'- GAGAGCCACATGTAGAGAACACTTTCC -3'

Sequencing Primer
(F):5'- CTGGCAGCAATGGCTTATGAC -3'
(R):5'- ATGTAGAGAACACTTTCCTCCTACC -3'
Posted On2013-06-12