Incidental Mutation 'R6147:Tbck'
ID488934
Institutional Source Beutler Lab
Gene Symbol Tbck
Ensembl Gene ENSMUSG00000028030
Gene NameTBC1 domain containing kinase
SynonymsA630047E20Rik, C030007I09Rik, 1700120J03Rik
MMRRC Submission 044294-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R6147 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location132684144-132841688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132694446 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 86 (K86R)
Ref Sequence ENSEMBL: ENSMUSP00000129205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169172]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000029664
SMART Domains Protein: ENSMUSP00000029664
Gene: ENSMUSG00000028030

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 6.2e-30 PFAM
Pfam:Pkinase 33 273 1.9e-39 PFAM
Pfam:Kinase-like 71 261 3.4e-8 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169172
AA Change: K86R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129205
Gene: ENSMUSG00000028030
AA Change: K86R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 4.5e-29 PFAM
Pfam:Pkinase 32 273 1.4e-39 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
RHOD 780 886 2.67e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198147
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.1%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a protein kinase domain, a Rhodanase-like domain and the Tre-2/Bub2/Cdc16 (TBC) domain. The encoded protein is thought to play a role in actin organization, cell growth and cell proliferation by regulating the mammalian target of the rapamycin (mTOR) signaling pathway. This protein may also be involved in the transcriptional regulation of the components of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,379,308 Y168C probably damaging Het
Acmsd C T 1: 127,729,420 probably benign Het
Acsf3 T A 8: 122,781,474 D236E probably damaging Het
Aqp1 G T 6: 55,336,610 E40D probably benign Het
Arfgef2 A G 2: 166,871,495 D1272G probably damaging Het
Arfip1 A G 3: 84,529,178 V97A probably benign Het
Atp6v1b2 T A 8: 69,102,482 Y165* probably null Het
BC051142 T C 17: 34,418,923 S31P possibly damaging Het
Bclaf1 T A 10: 20,323,425 D189E possibly damaging Het
Camsap2 G A 1: 136,345,400 T13M probably damaging Het
Cntn5 T A 9: 10,012,889 Y297F probably damaging Het
Cntnap5b G A 1: 100,050,781 C174Y probably damaging Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Comtd1 C A 14: 21,848,815 A20S probably damaging Het
Cspg4 A T 9: 56,888,772 R1264W probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dlgap2 T A 8: 14,727,294 C180S probably benign Het
Ednra C T 8: 77,667,322 probably benign Het
Ephb6 A T 6: 41,616,781 S533C probably damaging Het
Fndc1 A T 17: 7,753,762 probably null Het
Gif G A 19: 11,747,572 probably benign Het
Gm11639 T C 11: 104,967,740 V3875A unknown Het
Gm12185 A G 11: 48,915,890 I158T probably benign Het
Gm14325 A T 2: 177,832,807 C161S probably damaging Het
Gm17677 A T 9: 35,742,110 Y70F possibly damaging Het
Gm17677 A G 9: 35,742,232 T111A possibly damaging Het
Ighv9-1 T A 12: 114,094,220 Q20L probably damaging Het
Khnyn G C 14: 55,887,603 S438T probably damaging Het
Krt9 T C 11: 100,188,839 S576G unknown Het
Lrriq4 A T 3: 30,659,079 N443I probably damaging Het
Luzp1 A G 4: 136,541,063 Y199C probably damaging Het
Map2k3 T A 11: 60,949,950 Y268* probably null Het
Men1 T A 19: 6,337,242 D248E probably damaging Het
Mfsd4b2 A T 10: 39,921,577 C261S probably benign Het
Mpeg1 T G 19: 12,462,894 I572S probably damaging Het
Mrgprb2 A G 7: 48,552,365 V204A possibly damaging Het
Mycbp2 A T 14: 103,155,509 C805* probably null Het
Nphs2 A T 1: 156,318,726 K91* probably null Het
Obox3 A G 7: 15,626,001 S248P probably damaging Het
Olfr1054 A T 2: 86,332,500 N285K probably damaging Het
Olfr109 T C 17: 37,466,539 I111T probably benign Het
Olfr1152 C T 2: 87,868,717 T242I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pan3 T C 5: 147,548,283 probably benign Het
Pcdhb5 T A 18: 37,320,726 L53Q probably damaging Het
Pcdhb9 G T 18: 37,402,441 R496L possibly damaging Het
Peg10 C T 6: 4,754,499 probably benign Het
Plce1 A G 19: 38,702,037 K722E probably damaging Het
Plch1 A G 3: 63,722,881 S489P probably damaging Het
Plekhg3 T C 12: 76,565,211 V362A probably damaging Het
Radil G A 5: 142,497,940 H264Y probably benign Het
Ranbp2 C A 10: 58,479,428 T1990K probably damaging Het
Rnf207 T C 4: 152,315,655 D192G probably damaging Het
Ryr1 A T 7: 29,085,914 F1784Y possibly damaging Het
Set T A 2: 30,066,824 S2T probably benign Het
Slc26a2 T A 18: 61,201,685 Y232F probably damaging Het
Sntb1 T A 15: 55,648,010 M393L probably benign Het
Stx16 A G 2: 174,090,687 T18A probably damaging Het
Stxbp5 A T 10: 9,808,472 S585T possibly damaging Het
Sult2a7 T C 7: 14,465,163 E313G probably damaging Het
Tom1 A T 8: 75,054,692 Q255L possibly damaging Het
Trbv4 A G 6: 41,059,703 Y54C probably damaging Het
Trim34a A T 7: 104,261,191 Q400L probably damaging Het
Trim42 G T 9: 97,363,329 H473N probably benign Het
Tshr T A 12: 91,538,235 M649K possibly damaging Het
Vmn2r11 C T 5: 109,054,834 V126M probably benign Het
Vps13b T A 15: 35,930,031 H3971Q probably benign Het
Wdr75 T A 1: 45,819,538 N622K probably benign Het
Wdr93 A T 7: 79,758,497 Q242L probably benign Het
Other mutations in Tbck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tbck APN 3 132743093 splice site probably null
IGL00492:Tbck APN 3 132722740 missense probably benign 0.00
IGL01020:Tbck APN 3 132727142 nonsense probably null
IGL01111:Tbck APN 3 132694407 missense probably damaging 1.00
IGL01299:Tbck APN 3 132724877 missense probably damaging 0.98
IGL02456:Tbck APN 3 132734714 splice site probably benign
IGL02554:Tbck APN 3 132751192 nonsense probably null
IGL02640:Tbck APN 3 132774486 missense probably benign 0.26
IGL02960:Tbck APN 3 132722783 missense probably benign 0.01
IGL03184:Tbck APN 3 132736103 missense probably damaging 1.00
IGL03246:Tbck APN 3 132774570 missense probably benign
fear-4 UTSW 3 132724916 critical splice donor site probably null
Fuerchte UTSW 3 132722291 splice site probably benign
PIT1430001:Tbck UTSW 3 132722726 missense probably benign
PIT4802001:Tbck UTSW 3 132752666 missense probably damaging 1.00
R0113:Tbck UTSW 3 132743080 missense probably damaging 1.00
R0241:Tbck UTSW 3 132724875 missense probably benign
R0241:Tbck UTSW 3 132724875 missense probably benign
R0309:Tbck UTSW 3 132734407 nonsense probably null
R0375:Tbck UTSW 3 132751232 splice site probably benign
R0571:Tbck UTSW 3 132752642 missense probably damaging 1.00
R0831:Tbck UTSW 3 132722291 splice site probably benign
R1135:Tbck UTSW 3 132732191 missense probably damaging 0.97
R1184:Tbck UTSW 3 132837972 missense probably benign 0.01
R1560:Tbck UTSW 3 132838048 missense probably damaging 1.00
R1563:Tbck UTSW 3 132715693 missense possibly damaging 0.94
R1659:Tbck UTSW 3 132734355 missense probably damaging 1.00
R1799:Tbck UTSW 3 132774502 missense probably benign 0.01
R1830:Tbck UTSW 3 132838011 missense probably benign 0.40
R1884:Tbck UTSW 3 132724916 critical splice donor site probably null
R3406:Tbck UTSW 3 132727084 missense probably benign 0.41
R4021:Tbck UTSW 3 132727134 missense probably damaging 0.97
R4205:Tbck UTSW 3 132838028 missense probably benign 0.32
R4503:Tbck UTSW 3 132751220 missense probably benign 0.03
R4794:Tbck UTSW 3 132686968 missense possibly damaging 0.90
R4795:Tbck UTSW 3 132707798 missense possibly damaging 0.95
R4859:Tbck UTSW 3 132801527 missense probably benign 0.00
R5282:Tbck UTSW 3 132751216 missense possibly damaging 0.95
R5787:Tbck UTSW 3 132737568 missense probably damaging 1.00
R5987:Tbck UTSW 3 132801517 missense possibly damaging 0.53
R6145:Tbck UTSW 3 132732215 missense probably damaging 1.00
R6242:Tbck UTSW 3 132694428 missense probably benign 0.16
R6276:Tbck UTSW 3 132743005 missense probably damaging 1.00
R6912:Tbck UTSW 3 132686942 missense possibly damaging 0.50
R7107:Tbck UTSW 3 132722331 missense possibly damaging 0.73
R7191:Tbck UTSW 3 132737555 missense probably damaging 1.00
R7466:Tbck UTSW 3 132752563 missense probably damaging 0.99
R7719:Tbck UTSW 3 132734728 missense probably damaging 1.00
R8371:Tbck UTSW 3 132752524 missense possibly damaging 0.47
X0018:Tbck UTSW 3 132686800 start codon destroyed probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGACTGGTCACACGTGCAC -3'
(R):5'- GAGGAATTTTCTCAAGTGCTTTGTC -3'

Sequencing Primer
(F):5'- CACACGGTGAAAACGGATAGTAC -3'
(R):5'- GTGCTTTGTCAAATGTTACCACTG -3'
Posted On2017-10-10