Incidental Mutation 'R6147:Vmn2r11'
ID488937
Institutional Source Beutler Lab
Gene Symbol Vmn2r11
Ensembl Gene ENSMUSG00000091450
Gene Namevomeronasal 2, receptor 11
SynonymsEG384219
MMRRC Submission 044294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6147 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location109046873-109059452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109054834 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 126 (V126M)
Ref Sequence ENSEMBL: ENSMUSP00000133218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164875]
Predicted Effect probably benign
Transcript: ENSMUST00000164875
AA Change: V126M

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133218
Gene: ENSMUSG00000091450
AA Change: V126M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 167 475 1.6e-29 PFAM
Pfam:NCD3G 520 574 9.1e-19 PFAM
Pfam:7tm_3 607 842 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.1%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,379,308 Y168C probably damaging Het
Acmsd C T 1: 127,729,420 probably benign Het
Acsf3 T A 8: 122,781,474 D236E probably damaging Het
Aqp1 G T 6: 55,336,610 E40D probably benign Het
Arfgef2 A G 2: 166,871,495 D1272G probably damaging Het
Arfip1 A G 3: 84,529,178 V97A probably benign Het
Atp6v1b2 T A 8: 69,102,482 Y165* probably null Het
BC051142 T C 17: 34,418,923 S31P possibly damaging Het
Bclaf1 T A 10: 20,323,425 D189E possibly damaging Het
Camsap2 G A 1: 136,345,400 T13M probably damaging Het
Cntn5 T A 9: 10,012,889 Y297F probably damaging Het
Cntnap5b G A 1: 100,050,781 C174Y probably damaging Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Comtd1 C A 14: 21,848,815 A20S probably damaging Het
Cspg4 A T 9: 56,888,772 R1264W probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dlgap2 T A 8: 14,727,294 C180S probably benign Het
Ednra C T 8: 77,667,322 probably benign Het
Ephb6 A T 6: 41,616,781 S533C probably damaging Het
Fndc1 A T 17: 7,753,762 probably null Het
Gif G A 19: 11,747,572 probably benign Het
Gm11639 T C 11: 104,967,740 V3875A unknown Het
Gm12185 A G 11: 48,915,890 I158T probably benign Het
Gm14325 A T 2: 177,832,807 C161S probably damaging Het
Gm17677 A T 9: 35,742,110 Y70F possibly damaging Het
Gm17677 A G 9: 35,742,232 T111A possibly damaging Het
Ighv9-1 T A 12: 114,094,220 Q20L probably damaging Het
Khnyn G C 14: 55,887,603 S438T probably damaging Het
Krt9 T C 11: 100,188,839 S576G unknown Het
Lrriq4 A T 3: 30,659,079 N443I probably damaging Het
Luzp1 A G 4: 136,541,063 Y199C probably damaging Het
Map2k3 T A 11: 60,949,950 Y268* probably null Het
Men1 T A 19: 6,337,242 D248E probably damaging Het
Mfsd4b2 A T 10: 39,921,577 C261S probably benign Het
Mpeg1 T G 19: 12,462,894 I572S probably damaging Het
Mrgprb2 A G 7: 48,552,365 V204A possibly damaging Het
Mycbp2 A T 14: 103,155,509 C805* probably null Het
Nphs2 A T 1: 156,318,726 K91* probably null Het
Obox3 A G 7: 15,626,001 S248P probably damaging Het
Olfr1054 A T 2: 86,332,500 N285K probably damaging Het
Olfr109 T C 17: 37,466,539 I111T probably benign Het
Olfr1152 C T 2: 87,868,717 T242I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pan3 T C 5: 147,548,283 probably benign Het
Pcdhb5 T A 18: 37,320,726 L53Q probably damaging Het
Pcdhb9 G T 18: 37,402,441 R496L possibly damaging Het
Peg10 C T 6: 4,754,499 probably benign Het
Plce1 A G 19: 38,702,037 K722E probably damaging Het
Plch1 A G 3: 63,722,881 S489P probably damaging Het
Plekhg3 T C 12: 76,565,211 V362A probably damaging Het
Radil G A 5: 142,497,940 H264Y probably benign Het
Ranbp2 C A 10: 58,479,428 T1990K probably damaging Het
Rnf207 T C 4: 152,315,655 D192G probably damaging Het
Ryr1 A T 7: 29,085,914 F1784Y possibly damaging Het
Set T A 2: 30,066,824 S2T probably benign Het
Slc26a2 T A 18: 61,201,685 Y232F probably damaging Het
Sntb1 T A 15: 55,648,010 M393L probably benign Het
Stx16 A G 2: 174,090,687 T18A probably damaging Het
Stxbp5 A T 10: 9,808,472 S585T possibly damaging Het
Sult2a7 T C 7: 14,465,163 E313G probably damaging Het
Tbck A G 3: 132,694,446 K86R probably benign Het
Tom1 A T 8: 75,054,692 Q255L possibly damaging Het
Trbv4 A G 6: 41,059,703 Y54C probably damaging Het
Trim34a A T 7: 104,261,191 Q400L probably damaging Het
Trim42 G T 9: 97,363,329 H473N probably benign Het
Tshr T A 12: 91,538,235 M649K possibly damaging Het
Vps13b T A 15: 35,930,031 H3971Q probably benign Het
Wdr75 T A 1: 45,819,538 N622K probably benign Het
Wdr93 A T 7: 79,758,497 Q242L probably benign Het
Other mutations in Vmn2r11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Vmn2r11 APN 5 109047019 missense probably benign 0.00
IGL01677:Vmn2r11 APN 5 109053957 missense possibly damaging 0.50
IGL02048:Vmn2r11 APN 5 109054792 missense probably benign 0.00
IGL02559:Vmn2r11 APN 5 109052180 missense probably damaging 0.98
IGL02879:Vmn2r11 APN 5 109053838 missense possibly damaging 0.95
IGL03084:Vmn2r11 APN 5 109059343 missense probably benign 0.00
IGL03163:Vmn2r11 APN 5 109053826 missense probably benign 0.41
IGL03289:Vmn2r11 APN 5 109048922 splice site probably benign
IGL03294:Vmn2r11 APN 5 109054069 missense probably benign 0.22
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0421:Vmn2r11 UTSW 5 109059428 missense probably benign 0.00
R0549:Vmn2r11 UTSW 5 109052097 missense possibly damaging 0.80
R0628:Vmn2r11 UTSW 5 109047731 missense possibly damaging 0.88
R1523:Vmn2r11 UTSW 5 109053841 missense probably benign 0.25
R1660:Vmn2r11 UTSW 5 109053858 missense possibly damaging 0.79
R1827:Vmn2r11 UTSW 5 109052072 missense probably benign 0.01
R1913:Vmn2r11 UTSW 5 109054788 missense probably benign
R2260:Vmn2r11 UTSW 5 109053791 nonsense probably null
R2400:Vmn2r11 UTSW 5 109052062 missense probably benign 0.03
R3933:Vmn2r11 UTSW 5 109053394 missense probably damaging 0.97
R4091:Vmn2r11 UTSW 5 109054750 critical splice donor site probably null
R4624:Vmn2r11 UTSW 5 109052235 missense probably damaging 0.99
R4762:Vmn2r11 UTSW 5 109047570 missense probably damaging 1.00
R5256:Vmn2r11 UTSW 5 109054792 missense probably benign 0.26
R5370:Vmn2r11 UTSW 5 109047555 missense probably damaging 1.00
R5419:Vmn2r11 UTSW 5 109059358 missense possibly damaging 0.55
R5516:Vmn2r11 UTSW 5 109047166 missense probably damaging 0.98
R5643:Vmn2r11 UTSW 5 109047003 missense probably damaging 1.00
R5671:Vmn2r11 UTSW 5 109054906 missense probably benign 0.03
R5679:Vmn2r11 UTSW 5 109054842 missense probably benign 0.00
R5739:Vmn2r11 UTSW 5 109059248 critical splice donor site probably null
R5746:Vmn2r11 UTSW 5 109053694 missense probably benign 0.41
R5995:Vmn2r11 UTSW 5 109047055 missense probably damaging 1.00
R6220:Vmn2r11 UTSW 5 109053568 missense probably benign 0.09
R6374:Vmn2r11 UTSW 5 109053813 missense possibly damaging 0.65
R6491:Vmn2r11 UTSW 5 109048934 missense possibly damaging 0.95
R6804:Vmn2r11 UTSW 5 109053484 missense probably damaging 1.00
R6814:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R6872:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R7014:Vmn2r11 UTSW 5 109053423 missense probably damaging 1.00
R7041:Vmn2r11 UTSW 5 109054950 missense probably damaging 1.00
R7043:Vmn2r11 UTSW 5 109052232 missense probably benign 0.00
R7050:Vmn2r11 UTSW 5 109054791 missense probably benign 0.05
R7184:Vmn2r11 UTSW 5 109053415 missense probably damaging 1.00
R7388:Vmn2r11 UTSW 5 109054876 missense probably benign 0.05
R7477:Vmn2r11 UTSW 5 109059348 missense possibly damaging 0.67
R7524:Vmn2r11 UTSW 5 109053982 missense probably benign 0.01
R7682:Vmn2r11 UTSW 5 109047615 missense probably benign 0.02
R7715:Vmn2r11 UTSW 5 109047441 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTGCAGGCACATGTAAATGG -3'
(R):5'- TGCCTTGTTTTAGAATACCTACAAG -3'

Sequencing Primer
(F):5'- GAGGTCCTAAGTTCAATTCCCAGG -3'
(R):5'- CCTGATCTTTTACCCAACA -3'
Posted On2017-10-10