Incidental Mutation 'R6147:Trim34a'
ID488949
Institutional Source Beutler Lab
Gene Symbol Trim34a
Ensembl Gene ENSMUSG00000056144
Gene Nametripartite motif-containing 34A
SynonymsTrim34-1, Trim34
MMRRC Submission 044294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6147 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104244457-104262234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104261191 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 400 (Q400L)
Ref Sequence ENSEMBL: ENSMUSP00000102462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051795] [ENSMUST00000060315] [ENSMUST00000098179] [ENSMUST00000106848] [ENSMUST00000106849]
Predicted Effect probably benign
Transcript: ENSMUST00000051795
SMART Domains Protein: ENSMUSP00000050084
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
coiled coil region 172 232 N/A INTRINSIC
Pfam:SPRY 349 485 9.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060315
AA Change: Q400L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144
AA Change: Q400L

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098179
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106848
AA Change: Q400L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144
AA Change: Q400L

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106849
AA Change: Q400L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144
AA Change: Q400L

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217156
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.1%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,379,308 Y168C probably damaging Het
Acmsd C T 1: 127,729,420 probably benign Het
Acsf3 T A 8: 122,781,474 D236E probably damaging Het
Aqp1 G T 6: 55,336,610 E40D probably benign Het
Arfgef2 A G 2: 166,871,495 D1272G probably damaging Het
Arfip1 A G 3: 84,529,178 V97A probably benign Het
Atp6v1b2 T A 8: 69,102,482 Y165* probably null Het
BC051142 T C 17: 34,418,923 S31P possibly damaging Het
Bclaf1 T A 10: 20,323,425 D189E possibly damaging Het
Camsap2 G A 1: 136,345,400 T13M probably damaging Het
Cntn5 T A 9: 10,012,889 Y297F probably damaging Het
Cntnap5b G A 1: 100,050,781 C174Y probably damaging Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Comtd1 C A 14: 21,848,815 A20S probably damaging Het
Cspg4 A T 9: 56,888,772 R1264W probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dlgap2 T A 8: 14,727,294 C180S probably benign Het
Ednra C T 8: 77,667,322 probably benign Het
Ephb6 A T 6: 41,616,781 S533C probably damaging Het
Fndc1 A T 17: 7,753,762 probably null Het
Gif G A 19: 11,747,572 probably benign Het
Gm11639 T C 11: 104,967,740 V3875A unknown Het
Gm12185 A G 11: 48,915,890 I158T probably benign Het
Gm14325 A T 2: 177,832,807 C161S probably damaging Het
Gm17677 A T 9: 35,742,110 Y70F possibly damaging Het
Gm17677 A G 9: 35,742,232 T111A possibly damaging Het
Ighv9-1 T A 12: 114,094,220 Q20L probably damaging Het
Khnyn G C 14: 55,887,603 S438T probably damaging Het
Krt9 T C 11: 100,188,839 S576G unknown Het
Lrriq4 A T 3: 30,659,079 N443I probably damaging Het
Luzp1 A G 4: 136,541,063 Y199C probably damaging Het
Map2k3 T A 11: 60,949,950 Y268* probably null Het
Men1 T A 19: 6,337,242 D248E probably damaging Het
Mfsd4b2 A T 10: 39,921,577 C261S probably benign Het
Mpeg1 T G 19: 12,462,894 I572S probably damaging Het
Mrgprb2 A G 7: 48,552,365 V204A possibly damaging Het
Mycbp2 A T 14: 103,155,509 C805* probably null Het
Nphs2 A T 1: 156,318,726 K91* probably null Het
Obox3 A G 7: 15,626,001 S248P probably damaging Het
Olfr1054 A T 2: 86,332,500 N285K probably damaging Het
Olfr109 T C 17: 37,466,539 I111T probably benign Het
Olfr1152 C T 2: 87,868,717 T242I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pan3 T C 5: 147,548,283 probably benign Het
Pcdhb5 T A 18: 37,320,726 L53Q probably damaging Het
Pcdhb9 G T 18: 37,402,441 R496L possibly damaging Het
Peg10 C T 6: 4,754,499 probably benign Het
Plce1 A G 19: 38,702,037 K722E probably damaging Het
Plch1 A G 3: 63,722,881 S489P probably damaging Het
Plekhg3 T C 12: 76,565,211 V362A probably damaging Het
Radil G A 5: 142,497,940 H264Y probably benign Het
Ranbp2 C A 10: 58,479,428 T1990K probably damaging Het
Rnf207 T C 4: 152,315,655 D192G probably damaging Het
Ryr1 A T 7: 29,085,914 F1784Y possibly damaging Het
Set T A 2: 30,066,824 S2T probably benign Het
Slc26a2 T A 18: 61,201,685 Y232F probably damaging Het
Sntb1 T A 15: 55,648,010 M393L probably benign Het
Stx16 A G 2: 174,090,687 T18A probably damaging Het
Stxbp5 A T 10: 9,808,472 S585T possibly damaging Het
Sult2a7 T C 7: 14,465,163 E313G probably damaging Het
Tbck A G 3: 132,694,446 K86R probably benign Het
Tom1 A T 8: 75,054,692 Q255L possibly damaging Het
Trbv4 A G 6: 41,059,703 Y54C probably damaging Het
Trim42 G T 9: 97,363,329 H473N probably benign Het
Tshr T A 12: 91,538,235 M649K possibly damaging Het
Vmn2r11 C T 5: 109,054,834 V126M probably benign Het
Vps13b T A 15: 35,930,031 H3971Q probably benign Het
Wdr75 T A 1: 45,819,538 N622K probably benign Het
Wdr93 A T 7: 79,758,497 Q242L probably benign Het
Other mutations in Trim34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Trim34a APN 7 104261331 missense probably damaging 1.00
IGL00826:Trim34a APN 7 104260933 unclassified probably null
IGL01526:Trim34a APN 7 104260499 missense probably damaging 1.00
IGL01859:Trim34a APN 7 104260942 missense probably damaging 0.96
IGL02052:Trim34a APN 7 104247831 missense probably benign 0.33
IGL02192:Trim34a APN 7 104247732 start codon destroyed probably null 1.00
IGL02351:Trim34a APN 7 104261234 nonsense probably null
IGL02358:Trim34a APN 7 104261234 nonsense probably null
IGL03326:Trim34a APN 7 104261380 missense probably benign 0.03
IGL03366:Trim34a APN 7 104260933 unclassified probably null
gold_belt UTSW 7 104261064 nonsense probably null
PIT4472001:Trim34a UTSW 7 104247948 missense probably damaging 1.00
PIT4791001:Trim34a UTSW 7 104260484 missense probably benign 0.15
R0115:Trim34a UTSW 7 104247902 missense probably damaging 1.00
R0848:Trim34a UTSW 7 104261124 missense probably benign
R1016:Trim34a UTSW 7 104247960 missense probably benign 0.10
R1477:Trim34a UTSW 7 104248080 missense possibly damaging 0.81
R1622:Trim34a UTSW 7 104261338 unclassified probably null
R2287:Trim34a UTSW 7 104261055 missense probably damaging 1.00
R3685:Trim34a UTSW 7 104260126 unclassified probably null
R4166:Trim34a UTSW 7 104261016 missense probably benign 0.02
R4967:Trim34a UTSW 7 104261064 nonsense probably null
R4979:Trim34a UTSW 7 104247862 missense probably benign 0.00
R5194:Trim34a UTSW 7 104260993 missense possibly damaging 0.70
R5443:Trim34a UTSW 7 104260213 missense possibly damaging 0.80
R5631:Trim34a UTSW 7 104248739 missense probably damaging 1.00
R5902:Trim34a UTSW 7 104261121 nonsense probably null
R6644:Trim34a UTSW 7 104261037 missense probably damaging 1.00
R8060:Trim34a UTSW 7 104260976 missense not run
X0023:Trim34a UTSW 7 104259415 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TGGCCCTTTAAGTGTTGTAATAACG -3'
(R):5'- AGCAGCATTGGGAGAACTTG -3'

Sequencing Primer
(F):5'- AACGGTATCTTGGGCTCCAAATG -3'
(R):5'- GAACTTGTAAATGAGTGATCCATGG -3'
Posted On2017-10-10