Mutagenetix > Incidental Mutations

Incidental Mutation 'R6147:Sntb1'

488976

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

044294-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R6147 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55648010 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 393 (M393L)

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769]

Predicted Effect

probably benign
Transcript: ENSMUST00000039769
AA Change: M393L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: M393L

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 97.1%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,379,308	Y168C	probably damaging	Het
Acmsd	C	T	1: 127,729,420		probably benign	Het
Acsf3	T	A	8: 122,781,474	D236E	probably damaging	Het
Aqp1	G	T	6: 55,336,610	E40D	probably benign	Het
Arfgef2	A	G	2: 166,871,495	D1272G	probably damaging	Het
Arfip1	A	G	3: 84,529,178	V97A	probably benign	Het
Atp6v1b2	T	A	8: 69,102,482	Y165*	probably null	Het
BC051142	T	C	17: 34,418,923	S31P	possibly damaging	Het
Bclaf1	T	A	10: 20,323,425	D189E	possibly damaging	Het
Camsap2	G	A	1: 136,345,400	T13M	probably damaging	Het
Cntn5	T	A	9: 10,012,889	Y297F	probably damaging	Het
Cntnap5b	G	A	1: 100,050,781	C174Y	probably damaging	Het
Cntrl	A	C	2: 35,165,733	D1213A	possibly damaging	Het
Comtd1	C	A	14: 21,848,815	A20S	probably damaging	Het
Cspg4	A	T	9: 56,888,772	R1264W	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dlgap2	T	A	8: 14,727,294	C180S	probably benign	Het
Ednra	C	T	8: 77,667,322		probably benign	Het
Ephb6	A	T	6: 41,616,781	S533C	probably damaging	Het
Fndc1	A	T	17: 7,753,762		probably null	Het
Gif	G	A	19: 11,747,572		probably benign	Het
Gm11639	T	C	11: 104,967,740	V3875A	unknown	Het
Gm12185	A	G	11: 48,915,890	I158T	probably benign	Het
Gm14325	A	T	2: 177,832,807	C161S	probably damaging	Het
Gm17677	A	T	9: 35,742,110	Y70F	possibly damaging	Het
Gm17677	A	G	9: 35,742,232	T111A	possibly damaging	Het
Ighv9-1	T	A	12: 114,094,220	Q20L	probably damaging	Het
Khnyn	G	C	14: 55,887,603	S438T	probably damaging	Het
Krt9	T	C	11: 100,188,839	S576G	unknown	Het
Lrriq4	A	T	3: 30,659,079	N443I	probably damaging	Het
Luzp1	A	G	4: 136,541,063	Y199C	probably damaging	Het
Map2k3	T	A	11: 60,949,950	Y268*	probably null	Het
Men1	T	A	19: 6,337,242	D248E	probably damaging	Het
Mfsd4b2	A	T	10: 39,921,577	C261S	probably benign	Het
Mpeg1	T	G	19: 12,462,894	I572S	probably damaging	Het
Mrgprb2	A	G	7: 48,552,365	V204A	possibly damaging	Het
Mycbp2	A	T	14: 103,155,509	C805*	probably null	Het
Nphs2	A	T	1: 156,318,726	K91*	probably null	Het
Obox3	A	G	7: 15,626,001	S248P	probably damaging	Het
Olfr1054	A	T	2: 86,332,500	N285K	probably damaging	Het
Olfr109	T	C	17: 37,466,539	I111T	probably benign	Het
Olfr1152	C	T	2: 87,868,717	T242I	probably benign	Het
Otogl	G	A	10: 107,777,117		silent	Het
Pan3	T	C	5: 147,548,283		probably benign	Het
Pcdhb5	T	A	18: 37,320,726	L53Q	probably damaging	Het
Pcdhb9	G	T	18: 37,402,441	R496L	possibly damaging	Het
Peg10	C	T	6: 4,754,499		probably benign	Het
Plce1	A	G	19: 38,702,037	K722E	probably damaging	Het
Plch1	A	G	3: 63,722,881	S489P	probably damaging	Het
Plekhg3	T	C	12: 76,565,211	V362A	probably damaging	Het
Radil	G	A	5: 142,497,940	H264Y	probably benign	Het
Ranbp2	C	A	10: 58,479,428	T1990K	probably damaging	Het
Rnf207	T	C	4: 152,315,655	D192G	probably damaging	Het
Ryr1	A	T	7: 29,085,914	F1784Y	possibly damaging	Het
Set	T	A	2: 30,066,824	S2T	probably benign	Het
Slc26a2	T	A	18: 61,201,685	Y232F	probably damaging	Het
Stx16	A	G	2: 174,090,687	T18A	probably damaging	Het
Stxbp5	A	T	10: 9,808,472	S585T	possibly damaging	Het
Sult2a7	T	C	7: 14,465,163	E313G	probably damaging	Het
Tbck	A	G	3: 132,694,446	K86R	probably benign	Het
Tom1	A	T	8: 75,054,692	Q255L	possibly damaging	Het
Trbv4	A	G	6: 41,059,703	Y54C	probably damaging	Het
Trim34a	A	T	7: 104,261,191	Q400L	probably damaging	Het
Trim42	G	T	9: 97,363,329	H473N	probably benign	Het
Tshr	T	A	12: 91,538,235	M649K	possibly damaging	Het
Vmn2r11	C	T	5: 109,054,834	V126M	probably benign	Het
Vps13b	T	A	15: 35,930,031	H3971Q	probably benign	Het
Wdr75	T	A	1: 45,819,538	N622K	probably benign	Het
Wdr93	A	T	7: 79,758,497	Q242L	probably benign	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5313:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GCCAGAGCAGTTATGGTTTCAC -3'
(R):5'- ATCTTTGATTTGAGGTCGCAATGAG -3'

Sequencing Primer
(F):5'- ACATTGGTAGCTCATAGGCGGC -3'
(R):5'- CAATGAGTATTGCATAGGTTTGAGGC -3'

Posted On

2017-10-10