Incidental Mutation 'R6147:Sntb1'
ID488976
Institutional Source Beutler Lab
Gene Symbol Sntb1
Ensembl Gene ENSMUSG00000060429
Gene Namesyntrophin, basic 1
Synonyms59-1 DAP, beta1-Syntrophin
MMRRC Submission 044294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6147 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location55636388-55906949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55648010 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 393 (M393L)
Ref Sequence ENSEMBL: ENSMUSP00000041294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039769]
Predicted Effect probably benign
Transcript: ENSMUST00000039769
AA Change: M393L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: M393L

DomainStartEndE-ValueType
PH 19 299 5.14e0 SMART
PDZ 120 194 4.5e-17 SMART
PH 322 434 2.81e-8 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.1%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,379,308 Y168C probably damaging Het
Acmsd C T 1: 127,729,420 probably benign Het
Acsf3 T A 8: 122,781,474 D236E probably damaging Het
Aqp1 G T 6: 55,336,610 E40D probably benign Het
Arfgef2 A G 2: 166,871,495 D1272G probably damaging Het
Arfip1 A G 3: 84,529,178 V97A probably benign Het
Atp6v1b2 T A 8: 69,102,482 Y165* probably null Het
BC051142 T C 17: 34,418,923 S31P possibly damaging Het
Bclaf1 T A 10: 20,323,425 D189E possibly damaging Het
Camsap2 G A 1: 136,345,400 T13M probably damaging Het
Cntn5 T A 9: 10,012,889 Y297F probably damaging Het
Cntnap5b G A 1: 100,050,781 C174Y probably damaging Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Comtd1 C A 14: 21,848,815 A20S probably damaging Het
Cspg4 A T 9: 56,888,772 R1264W probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dlgap2 T A 8: 14,727,294 C180S probably benign Het
Ednra C T 8: 77,667,322 probably benign Het
Ephb6 A T 6: 41,616,781 S533C probably damaging Het
Fndc1 A T 17: 7,753,762 probably null Het
Gif G A 19: 11,747,572 probably benign Het
Gm11639 T C 11: 104,967,740 V3875A unknown Het
Gm12185 A G 11: 48,915,890 I158T probably benign Het
Gm14325 A T 2: 177,832,807 C161S probably damaging Het
Gm17677 A T 9: 35,742,110 Y70F possibly damaging Het
Gm17677 A G 9: 35,742,232 T111A possibly damaging Het
Ighv9-1 T A 12: 114,094,220 Q20L probably damaging Het
Khnyn G C 14: 55,887,603 S438T probably damaging Het
Krt9 T C 11: 100,188,839 S576G unknown Het
Lrriq4 A T 3: 30,659,079 N443I probably damaging Het
Luzp1 A G 4: 136,541,063 Y199C probably damaging Het
Map2k3 T A 11: 60,949,950 Y268* probably null Het
Men1 T A 19: 6,337,242 D248E probably damaging Het
Mfsd4b2 A T 10: 39,921,577 C261S probably benign Het
Mpeg1 T G 19: 12,462,894 I572S probably damaging Het
Mrgprb2 A G 7: 48,552,365 V204A possibly damaging Het
Mycbp2 A T 14: 103,155,509 C805* probably null Het
Nphs2 A T 1: 156,318,726 K91* probably null Het
Obox3 A G 7: 15,626,001 S248P probably damaging Het
Olfr1054 A T 2: 86,332,500 N285K probably damaging Het
Olfr109 T C 17: 37,466,539 I111T probably benign Het
Olfr1152 C T 2: 87,868,717 T242I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pan3 T C 5: 147,548,283 probably benign Het
Pcdhb5 T A 18: 37,320,726 L53Q probably damaging Het
Pcdhb9 G T 18: 37,402,441 R496L possibly damaging Het
Peg10 C T 6: 4,754,499 probably benign Het
Plce1 A G 19: 38,702,037 K722E probably damaging Het
Plch1 A G 3: 63,722,881 S489P probably damaging Het
Plekhg3 T C 12: 76,565,211 V362A probably damaging Het
Radil G A 5: 142,497,940 H264Y probably benign Het
Ranbp2 C A 10: 58,479,428 T1990K probably damaging Het
Rnf207 T C 4: 152,315,655 D192G probably damaging Het
Ryr1 A T 7: 29,085,914 F1784Y possibly damaging Het
Set T A 2: 30,066,824 S2T probably benign Het
Slc26a2 T A 18: 61,201,685 Y232F probably damaging Het
Stx16 A G 2: 174,090,687 T18A probably damaging Het
Stxbp5 A T 10: 9,808,472 S585T possibly damaging Het
Sult2a7 T C 7: 14,465,163 E313G probably damaging Het
Tbck A G 3: 132,694,446 K86R probably benign Het
Tom1 A T 8: 75,054,692 Q255L possibly damaging Het
Trbv4 A G 6: 41,059,703 Y54C probably damaging Het
Trim34a A T 7: 104,261,191 Q400L probably damaging Het
Trim42 G T 9: 97,363,329 H473N probably benign Het
Tshr T A 12: 91,538,235 M649K possibly damaging Het
Vmn2r11 C T 5: 109,054,834 V126M probably benign Het
Vps13b T A 15: 35,930,031 H3971Q probably benign Het
Wdr75 T A 1: 45,819,538 N622K probably benign Het
Wdr93 A T 7: 79,758,497 Q242L probably benign Het
Other mutations in Sntb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Sntb1 APN 15 55648039 missense possibly damaging 0.93
IGL02732:Sntb1 APN 15 55792200 missense possibly damaging 0.62
IGL02965:Sntb1 APN 15 55642685 nonsense probably null
IGL03084:Sntb1 APN 15 55792091 missense probably damaging 0.99
IGL03286:Sntb1 APN 15 55792046 missense possibly damaging 0.59
R0117:Sntb1 UTSW 15 55906353 missense probably benign
R0178:Sntb1 UTSW 15 55906144 missense probably damaging 0.98
R0465:Sntb1 UTSW 15 55749276 missense probably benign 0.02
R0626:Sntb1 UTSW 15 55642783 missense probably benign 0.20
R0726:Sntb1 UTSW 15 55676356 missense probably benign
R1125:Sntb1 UTSW 15 55749280 missense probably benign
R1443:Sntb1 UTSW 15 55647955 missense probably damaging 1.00
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R1888:Sntb1 UTSW 15 55749349 nonsense probably null
R2208:Sntb1 UTSW 15 55906318 missense possibly damaging 0.79
R2426:Sntb1 UTSW 15 55906179 missense probably damaging 1.00
R3721:Sntb1 UTSW 15 55642818 missense probably benign 0.10
R4370:Sntb1 UTSW 15 55792091 missense probably damaging 0.99
R4706:Sntb1 UTSW 15 55749274 missense probably benign 0.09
R4883:Sntb1 UTSW 15 55642802 nonsense probably null
R5223:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5242:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5270:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5313:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5314:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5316:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5336:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5337:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5396:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5398:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5427:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5428:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5429:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5431:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5594:Sntb1 UTSW 15 55642795 missense probably damaging 1.00
R5658:Sntb1 UTSW 15 55792076 missense probably damaging 1.00
R5665:Sntb1 UTSW 15 55792139 missense probably benign 0.00
R6159:Sntb1 UTSW 15 55676302 critical splice donor site probably null
R6883:Sntb1 UTSW 15 55906323 missense probably benign 0.38
R7008:Sntb1 UTSW 15 55792072 nonsense probably null
R7168:Sntb1 UTSW 15 55791265 missense probably benign 0.00
R7511:Sntb1 UTSW 15 55647951 missense possibly damaging 0.71
R7600:Sntb1 UTSW 15 55792188 missense possibly damaging 0.82
R8242:Sntb1 UTSW 15 55792233 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCAGAGCAGTTATGGTTTCAC -3'
(R):5'- ATCTTTGATTTGAGGTCGCAATGAG -3'

Sequencing Primer
(F):5'- ACATTGGTAGCTCATAGGCGGC -3'
(R):5'- CAATGAGTATTGCATAGGTTTGAGGC -3'
Posted On2017-10-10