Incidental Mutation 'R6147:Olfr109'
ID488978
Institutional Source Beutler Lab
Gene Symbol Olfr109
Ensembl Gene ENSMUSG00000029184
Gene Nameolfactory receptor 109
SynonymsGA_x6K02T2PSCP-1914078-1915022, MOR250-1
MMRRC Submission 044294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6147 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37458916-37471590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37466539 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 111 (I111T)
Ref Sequence ENSEMBL: ENSMUSP00000150044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031086] [ENSMUST00000214668] [ENSMUST00000214938] [ENSMUST00000217602]
Predicted Effect probably benign
Transcript: ENSMUST00000031086
AA Change: I111T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000031086
Gene: ENSMUSG00000029184
AA Change: I111T

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 3.4e-54 PFAM
Pfam:7tm_1 39 291 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214668
AA Change: I111T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000214938
AA Change: I111T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000217602
AA Change: I111T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.1%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,379,308 Y168C probably damaging Het
Acmsd C T 1: 127,729,420 probably benign Het
Acsf3 T A 8: 122,781,474 D236E probably damaging Het
Aqp1 G T 6: 55,336,610 E40D probably benign Het
Arfgef2 A G 2: 166,871,495 D1272G probably damaging Het
Arfip1 A G 3: 84,529,178 V97A probably benign Het
Atp6v1b2 T A 8: 69,102,482 Y165* probably null Het
BC051142 T C 17: 34,418,923 S31P possibly damaging Het
Bclaf1 T A 10: 20,323,425 D189E possibly damaging Het
Camsap2 G A 1: 136,345,400 T13M probably damaging Het
Cntn5 T A 9: 10,012,889 Y297F probably damaging Het
Cntnap5b G A 1: 100,050,781 C174Y probably damaging Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Comtd1 C A 14: 21,848,815 A20S probably damaging Het
Cspg4 A T 9: 56,888,772 R1264W probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dlgap2 T A 8: 14,727,294 C180S probably benign Het
Ednra C T 8: 77,667,322 probably benign Het
Ephb6 A T 6: 41,616,781 S533C probably damaging Het
Fndc1 A T 17: 7,753,762 probably null Het
Gif G A 19: 11,747,572 probably benign Het
Gm11639 T C 11: 104,967,740 V3875A unknown Het
Gm12185 A G 11: 48,915,890 I158T probably benign Het
Gm14325 A T 2: 177,832,807 C161S probably damaging Het
Gm17677 A T 9: 35,742,110 Y70F possibly damaging Het
Gm17677 A G 9: 35,742,232 T111A possibly damaging Het
Ighv9-1 T A 12: 114,094,220 Q20L probably damaging Het
Khnyn G C 14: 55,887,603 S438T probably damaging Het
Krt9 T C 11: 100,188,839 S576G unknown Het
Lrriq4 A T 3: 30,659,079 N443I probably damaging Het
Luzp1 A G 4: 136,541,063 Y199C probably damaging Het
Map2k3 T A 11: 60,949,950 Y268* probably null Het
Men1 T A 19: 6,337,242 D248E probably damaging Het
Mfsd4b2 A T 10: 39,921,577 C261S probably benign Het
Mpeg1 T G 19: 12,462,894 I572S probably damaging Het
Mrgprb2 A G 7: 48,552,365 V204A possibly damaging Het
Mycbp2 A T 14: 103,155,509 C805* probably null Het
Nphs2 A T 1: 156,318,726 K91* probably null Het
Obox3 A G 7: 15,626,001 S248P probably damaging Het
Olfr1054 A T 2: 86,332,500 N285K probably damaging Het
Olfr1152 C T 2: 87,868,717 T242I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pan3 T C 5: 147,548,283 probably benign Het
Pcdhb5 T A 18: 37,320,726 L53Q probably damaging Het
Pcdhb9 G T 18: 37,402,441 R496L possibly damaging Het
Peg10 C T 6: 4,754,499 probably benign Het
Plce1 A G 19: 38,702,037 K722E probably damaging Het
Plch1 A G 3: 63,722,881 S489P probably damaging Het
Plekhg3 T C 12: 76,565,211 V362A probably damaging Het
Radil G A 5: 142,497,940 H264Y probably benign Het
Ranbp2 C A 10: 58,479,428 T1990K probably damaging Het
Rnf207 T C 4: 152,315,655 D192G probably damaging Het
Ryr1 A T 7: 29,085,914 F1784Y possibly damaging Het
Set T A 2: 30,066,824 S2T probably benign Het
Slc26a2 T A 18: 61,201,685 Y232F probably damaging Het
Sntb1 T A 15: 55,648,010 M393L probably benign Het
Stx16 A G 2: 174,090,687 T18A probably damaging Het
Stxbp5 A T 10: 9,808,472 S585T possibly damaging Het
Sult2a7 T C 7: 14,465,163 E313G probably damaging Het
Tbck A G 3: 132,694,446 K86R probably benign Het
Tom1 A T 8: 75,054,692 Q255L possibly damaging Het
Trbv4 A G 6: 41,059,703 Y54C probably damaging Het
Trim34a A T 7: 104,261,191 Q400L probably damaging Het
Trim42 G T 9: 97,363,329 H473N probably benign Het
Tshr T A 12: 91,538,235 M649K possibly damaging Het
Vmn2r11 C T 5: 109,054,834 V126M probably benign Het
Vps13b T A 15: 35,930,031 H3971Q probably benign Het
Wdr75 T A 1: 45,819,538 N622K probably benign Het
Wdr93 A T 7: 79,758,497 Q242L probably benign Het
Other mutations in Olfr109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Olfr109 APN 17 37466758 missense probably damaging 1.00
IGL02039:Olfr109 APN 17 37466449 missense possibly damaging 0.49
IGL02391:Olfr109 APN 17 37466586 missense probably damaging 1.00
IGL02730:Olfr109 APN 17 37466859 missense probably damaging 1.00
IGL02751:Olfr109 APN 17 37466415 missense probably damaging 0.98
IGL02891:Olfr109 APN 17 37466944 missense probably damaging 1.00
IGL03023:Olfr109 APN 17 37466994 missense probably benign
IGL03343:Olfr109 APN 17 37466409 missense probably damaging 1.00
R0026:Olfr109 UTSW 17 37466803 missense probably damaging 0.99
R0579:Olfr109 UTSW 17 37466347 missense probably benign 0.01
R1751:Olfr109 UTSW 17 37466901 missense probably benign 0.00
R1848:Olfr109 UTSW 17 37467047 missense probably damaging 0.99
R2392:Olfr109 UTSW 17 37466419 missense probably damaging 1.00
R4249:Olfr109 UTSW 17 37466824 missense probably damaging 0.98
R4464:Olfr109 UTSW 17 37466851 missense probably damaging 1.00
R4857:Olfr109 UTSW 17 37466823 missense possibly damaging 0.80
R4947:Olfr109 UTSW 17 37466743 missense probably damaging 1.00
R5107:Olfr109 UTSW 17 37466253 missense probably damaging 0.97
R5526:Olfr109 UTSW 17 37467112 missense unknown
R6416:Olfr109 UTSW 17 37467080 nonsense probably null
R7450:Olfr109 UTSW 17 37466616 missense probably benign 0.00
R7487:Olfr109 UTSW 17 37466566 missense probably damaging 0.96
R7822:Olfr109 UTSW 17 37467103 missense probably benign 0.00
R8041:Olfr109 UTSW 17 37466649 missense probably benign
R8051:Olfr109 UTSW 17 37466322 missense probably damaging 1.00
X0063:Olfr109 UTSW 17 37466524 missense probably damaging 1.00
X0065:Olfr109 UTSW 17 37466318 missense probably damaging 1.00
Z1176:Olfr109 UTSW 17 37466661 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GATCGTCACTCTGGAAAGAAGAC -3'
(R):5'- GGGGCTTGACATCACAGAAG -3'

Sequencing Primer
(F):5'- GTCACTCTGGAAAGAAGACTCCACTC -3'
(R):5'- CTTGACATCACAGAAGAAATGACTG -3'
Posted On2017-10-10