Incidental Mutation 'R6147:Mpeg1'
ID488984
Institutional Source Beutler Lab
Gene Symbol Mpeg1
Ensembl Gene ENSMUSG00000046805
Gene Namemacrophage expressed gene 1
SynonymsMPS1, Mpg-1
MMRRC Submission 044294-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6147 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12460779-12465284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12462894 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 572 (I572S)
Ref Sequence ENSEMBL: ENSMUSP00000108573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521] [ENSMUST00000081035]
Predicted Effect probably benign
Transcript: ENSMUST00000045521
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000081035
AA Change: I572S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108573
Gene: ENSMUSG00000046805
AA Change: I572S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MACPF 151 350 2.13e-58 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 685 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.1%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,379,308 Y168C probably damaging Het
Acmsd C T 1: 127,729,420 probably benign Het
Acsf3 T A 8: 122,781,474 D236E probably damaging Het
Aqp1 G T 6: 55,336,610 E40D probably benign Het
Arfgef2 A G 2: 166,871,495 D1272G probably damaging Het
Arfip1 A G 3: 84,529,178 V97A probably benign Het
Atp6v1b2 T A 8: 69,102,482 Y165* probably null Het
BC051142 T C 17: 34,418,923 S31P possibly damaging Het
Bclaf1 T A 10: 20,323,425 D189E possibly damaging Het
Camsap2 G A 1: 136,345,400 T13M probably damaging Het
Cntn5 T A 9: 10,012,889 Y297F probably damaging Het
Cntnap5b G A 1: 100,050,781 C174Y probably damaging Het
Cntrl A C 2: 35,165,733 D1213A possibly damaging Het
Comtd1 C A 14: 21,848,815 A20S probably damaging Het
Cspg4 A T 9: 56,888,772 R1264W probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dlgap2 T A 8: 14,727,294 C180S probably benign Het
Ednra C T 8: 77,667,322 probably benign Het
Ephb6 A T 6: 41,616,781 S533C probably damaging Het
Fndc1 A T 17: 7,753,762 probably null Het
Gif G A 19: 11,747,572 probably benign Het
Gm11639 T C 11: 104,967,740 V3875A unknown Het
Gm12185 A G 11: 48,915,890 I158T probably benign Het
Gm14325 A T 2: 177,832,807 C161S probably damaging Het
Gm17677 A T 9: 35,742,110 Y70F possibly damaging Het
Gm17677 A G 9: 35,742,232 T111A possibly damaging Het
Ighv9-1 T A 12: 114,094,220 Q20L probably damaging Het
Khnyn G C 14: 55,887,603 S438T probably damaging Het
Krt9 T C 11: 100,188,839 S576G unknown Het
Lrriq4 A T 3: 30,659,079 N443I probably damaging Het
Luzp1 A G 4: 136,541,063 Y199C probably damaging Het
Map2k3 T A 11: 60,949,950 Y268* probably null Het
Men1 T A 19: 6,337,242 D248E probably damaging Het
Mfsd4b2 A T 10: 39,921,577 C261S probably benign Het
Mrgprb2 A G 7: 48,552,365 V204A possibly damaging Het
Mycbp2 A T 14: 103,155,509 C805* probably null Het
Nphs2 A T 1: 156,318,726 K91* probably null Het
Obox3 A G 7: 15,626,001 S248P probably damaging Het
Olfr1054 A T 2: 86,332,500 N285K probably damaging Het
Olfr109 T C 17: 37,466,539 I111T probably benign Het
Olfr1152 C T 2: 87,868,717 T242I probably benign Het
Otogl G A 10: 107,777,117 silent Het
Pan3 T C 5: 147,548,283 probably benign Het
Pcdhb5 T A 18: 37,320,726 L53Q probably damaging Het
Pcdhb9 G T 18: 37,402,441 R496L possibly damaging Het
Peg10 C T 6: 4,754,499 probably benign Het
Plce1 A G 19: 38,702,037 K722E probably damaging Het
Plch1 A G 3: 63,722,881 S489P probably damaging Het
Plekhg3 T C 12: 76,565,211 V362A probably damaging Het
Radil G A 5: 142,497,940 H264Y probably benign Het
Ranbp2 C A 10: 58,479,428 T1990K probably damaging Het
Rnf207 T C 4: 152,315,655 D192G probably damaging Het
Ryr1 A T 7: 29,085,914 F1784Y possibly damaging Het
Set T A 2: 30,066,824 S2T probably benign Het
Slc26a2 T A 18: 61,201,685 Y232F probably damaging Het
Sntb1 T A 15: 55,648,010 M393L probably benign Het
Stx16 A G 2: 174,090,687 T18A probably damaging Het
Stxbp5 A T 10: 9,808,472 S585T possibly damaging Het
Sult2a7 T C 7: 14,465,163 E313G probably damaging Het
Tbck A G 3: 132,694,446 K86R probably benign Het
Tom1 A T 8: 75,054,692 Q255L possibly damaging Het
Trbv4 A G 6: 41,059,703 Y54C probably damaging Het
Trim34a A T 7: 104,261,191 Q400L probably damaging Het
Trim42 G T 9: 97,363,329 H473N probably benign Het
Tshr T A 12: 91,538,235 M649K possibly damaging Het
Vmn2r11 C T 5: 109,054,834 V126M probably benign Het
Vps13b T A 15: 35,930,031 H3971Q probably benign Het
Wdr75 T A 1: 45,819,538 N622K probably benign Het
Wdr93 A T 7: 79,758,497 Q242L probably benign Het
Other mutations in Mpeg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mpeg1 APN 19 12462710 missense probably benign 0.39
IGL00902:Mpeg1 APN 19 12461769 missense probably damaging 1.00
IGL01141:Mpeg1 APN 19 12462785 missense probably damaging 1.00
IGL02037:Mpeg1 APN 19 12463296 missense probably benign 0.04
IGL02447:Mpeg1 APN 19 12462792 missense probably damaging 1.00
IGL02448:Mpeg1 APN 19 12462609 missense probably benign
IGL02510:Mpeg1 APN 19 12461424 missense probably damaging 1.00
IGL03068:Mpeg1 APN 19 12462206 missense probably benign 0.01
R0128:Mpeg1 UTSW 19 12461223 missense probably benign 0.00
R0310:Mpeg1 UTSW 19 12461691 missense probably benign 0.00
R0312:Mpeg1 UTSW 19 12462403 missense probably damaging 1.00
R0522:Mpeg1 UTSW 19 12461759 missense probably damaging 0.99
R1356:Mpeg1 UTSW 19 12461325 missense probably damaging 0.98
R1396:Mpeg1 UTSW 19 12462804 missense probably damaging 1.00
R1436:Mpeg1 UTSW 19 12462459 missense probably damaging 0.98
R1497:Mpeg1 UTSW 19 12461247 missense probably benign 0.04
R1714:Mpeg1 UTSW 19 12462834 missense probably damaging 1.00
R1846:Mpeg1 UTSW 19 12463122 missense probably benign 0.00
R1856:Mpeg1 UTSW 19 12462356 missense probably benign 0.04
R1933:Mpeg1 UTSW 19 12462647 nonsense probably null
R1959:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1960:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R1961:Mpeg1 UTSW 19 12462911 missense probably damaging 1.00
R2240:Mpeg1 UTSW 19 12463038 missense probably damaging 0.98
R2474:Mpeg1 UTSW 19 12462249 missense probably damaging 1.00
R3430:Mpeg1 UTSW 19 12463128 missense probably benign 0.22
R4079:Mpeg1 UTSW 19 12462270 missense probably damaging 0.99
R4245:Mpeg1 UTSW 19 12462908 missense probably damaging 0.99
R4451:Mpeg1 UTSW 19 12463232 nonsense probably null
R4888:Mpeg1 UTSW 19 12463070 missense probably damaging 1.00
R4980:Mpeg1 UTSW 19 12461540 missense probably damaging 1.00
R5071:Mpeg1 UTSW 19 12461181 start codon destroyed probably null 0.02
R5089:Mpeg1 UTSW 19 12462997 missense probably benign 0.00
R5120:Mpeg1 UTSW 19 12461429 nonsense probably null
R5327:Mpeg1 UTSW 19 12461649 missense probably damaging 1.00
R5490:Mpeg1 UTSW 19 12461693 missense probably damaging 0.99
R5725:Mpeg1 UTSW 19 12462636 missense probably benign 0.13
R6243:Mpeg1 UTSW 19 12462240 missense probably benign 0.26
R6486:Mpeg1 UTSW 19 12462105 missense probably damaging 1.00
R6520:Mpeg1 UTSW 19 12461958 missense probably benign 0.04
R7139:Mpeg1 UTSW 19 12461714 missense probably benign 0.07
R7204:Mpeg1 UTSW 19 12462894 missense probably damaging 1.00
R7310:Mpeg1 UTSW 19 12462251 missense probably damaging 0.99
R7665:Mpeg1 UTSW 19 12463094 missense probably damaging 1.00
R7674:Mpeg1 UTSW 19 12461387 missense probably benign
R8388:Mpeg1 UTSW 19 12462914 missense probably damaging 1.00
X0064:Mpeg1 UTSW 19 12461972 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTCAAGGTATGTGTGTCCCTG -3'
(R):5'- ACTGTCATGGCCCTACGAAG -3'

Sequencing Primer
(F):5'- CAAGGTATGTGTGTCCCTGGATTATG -3'
(R):5'- AAGCTCCAGAGGTTCTCCCAG -3'
Posted On2017-10-10