Mutagenetix > Incidental Mutation

Incidental Mutation 'R6148:Agbl3'

489015

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

044295-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6148 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34857753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 952 (S952R)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably benign
Transcript: ENSMUST00000115016
AA Change: S957R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: S957R

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115017
AA Change: S952R

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: S952R

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202329

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

95% (61/64)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,187,426	C1067S	possibly damaging	Het
Ano9	A	G	7: 141,106,785	Y429H	probably damaging	Het
Bbs7	C	A	3: 36,613,266	R7L	probably damaging	Het
Birc3	T	A	9: 7,849,683	D535V	possibly damaging	Het
Catsper4	A	G	4: 134,217,929	V206A	probably damaging	Het
Ccdc73	T	G	2: 104,992,137	S810R	possibly damaging	Het
Cd177	A	T	7: 24,744,273	L800*	probably null	Het
Cd34	T	C	1: 194,948,008		probably null	Het
Cep78	G	A	19: 15,981,786	R95*	probably null	Het
Cfap69	T	C	5: 5,663,996	D12G	probably benign	Het
Cpne7	A	G	8: 123,127,432	D286G	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cxcl5	A	T	5: 90,759,706	I46L	probably benign	Het
Cyp19a1	C	T	9: 54,180,256	G59D	probably damaging	Het
Dclre1c	A	G	2: 3,437,705	D35G	probably damaging	Het
Dvl1	A	G	4: 155,854,952	Y279C	probably damaging	Het
Fes	A	G	7: 80,380,296	L578P	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fmn2	T	C	1: 174,666,663	S1248P	probably damaging	Het
Fmo1	T	G	1: 162,851,519	S53R	probably damaging	Het
Gabrg1	A	T	5: 70,774,461	M313K	probably damaging	Het
Galnt10	T	C	11: 57,784,648	C578R	probably damaging	Het
Gm13178	T	C	4: 144,721,317	T30A	possibly damaging	Het
Gm15293	A	G	8: 21,202,412	N83S	probably benign	Het
Gpr39	T	C	1: 125,872,586	V358A	probably damaging	Het
Gsap	A	G	5: 21,226,325	R216G	probably damaging	Het
Gsap	A	T	5: 21,270,577	T570S	probably benign	Het
Gucy2d	A	T	7: 98,443,823	I136L	probably benign	Het
Hap1	A	T	11: 100,349,392	V294E	probably damaging	Het
Ipo8	A	G	6: 148,799,780	V514A	probably damaging	Het
Irf5	T	C	6: 29,535,959	L324P	probably damaging	Het
Itsn1	C	T	16: 91,816,852	R251C	probably damaging	Het
Klf11	T	C	12: 24,651,568		probably null	Het
Kpna6	G	A	4: 129,649,306	Q439*	probably null	Het
Mark4	A	T	7: 19,429,516	S563T	probably benign	Het
Mrpl21	A	T	19: 3,283,084	I5L	probably benign	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Myrf	G	A	19: 10,212,475	T815I	probably damaging	Het
Olfr1211	C	T	2: 88,930,253	V21I	probably benign	Het
Olfr515-ps1	A	T	7: 108,844,971		probably null	Het
Olfr665	A	G	7: 104,881,082	Y125C	possibly damaging	Het
Olfr743	A	G	14: 50,534,321	N303S	probably benign	Het
Olfr961	G	T	9: 39,647,259	D178Y	probably damaging	Het
Os9	T	C	10: 127,099,943	D280G	probably benign	Het
Pcdhb14	A	G	18: 37,449,230	N463S	probably damaging	Het
Pex19	G	A	1: 172,134,039	E271K	probably damaging	Het
Ppdpf	G	A	2: 181,187,848	S32N	probably benign	Het
Prdm2	A	G	4: 143,132,907	I1271T	probably benign	Het
Rbbp4	T	C	4: 129,321,958	T262A	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Sult1e1	A	T	5: 87,579,911	S171T	probably damaging	Het
Tns1	T	C	1: 73,953,453	T689A	probably damaging	Het
Unc13c	G	C	9: 73,693,366	N1365K	probably benign	Het
Vmn2r52	T	C	7: 10,171,163	I250V	probably benign	Het
Vmn2r55	C	A	7: 12,668,142	L406F	probably benign	Het
Wdcp	T	C	12: 4,850,621	V159A	possibly damaging	Het
Zbtb3	C	T	19: 8,804,196	A391V	probably benign	Het
Znhit1	A	T	5: 136,982,633	S109T	probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGATACAGCATACCTTGGACAC -3'
(R):5'- GTTCTTGGAGGCACTTTCAGC -3'

Sequencing Primer
(F):5'- TCTTATGACAGACACCTCCGAATGG -3'
(R):5'- GGCACTTTCAGCCCAGTTAACTG -3'

Posted On

2017-10-10