Incidental Mutation 'R6148:Cd177'
ID489020
Institutional Source Beutler Lab
Gene Symbol Cd177
Ensembl Gene ENSMUSG00000052212
Gene NameCD177 antigen
SynonymsPdp3, 1190003K14Rik
MMRRC Submission 044295-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R6148 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24743983-24760311 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 24744273 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 800 (L800*)
Ref Sequence ENSEMBL: ENSMUSP00000064934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063956]
Predicted Effect probably null
Transcript: ENSMUST00000063956
AA Change: L800*
SMART Domains Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: L800*

DomainStartEndE-ValueType
Pfam:UPAR_LY6 134 214 3.7e-11 PFAM
Pfam:UPAR_LY6 226 300 1.2e-4 PFAM
low complexity region 301 317 N/A INTRINSIC
Pfam:UPAR_LY6 322 400 1.5e-9 PFAM
Pfam:UPAR_LY6 511 586 9.1e-12 PFAM
Pfam:UPAR_LY6 705 782 1.4e-11 PFAM
low complexity region 795 811 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206160
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,187,426 C1067S possibly damaging Het
Agbl3 T A 6: 34,857,753 S952R possibly damaging Het
Ano9 A G 7: 141,106,785 Y429H probably damaging Het
Bbs7 C A 3: 36,613,266 R7L probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Catsper4 A G 4: 134,217,929 V206A probably damaging Het
Ccdc73 T G 2: 104,992,137 S810R possibly damaging Het
Cd34 T C 1: 194,948,008 probably null Het
Cep78 G A 19: 15,981,786 R95* probably null Het
Cfap69 T C 5: 5,663,996 D12G probably benign Het
Cpne7 A G 8: 123,127,432 D286G probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cxcl5 A T 5: 90,759,706 I46L probably benign Het
Cyp19a1 C T 9: 54,180,256 G59D probably damaging Het
Dclre1c A G 2: 3,437,705 D35G probably damaging Het
Dvl1 A G 4: 155,854,952 Y279C probably damaging Het
Fes A G 7: 80,380,296 L578P probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fmn2 T C 1: 174,666,663 S1248P probably damaging Het
Fmo1 T G 1: 162,851,519 S53R probably damaging Het
Gabrg1 A T 5: 70,774,461 M313K probably damaging Het
Galnt10 T C 11: 57,784,648 C578R probably damaging Het
Gm13178 T C 4: 144,721,317 T30A possibly damaging Het
Gm15293 A G 8: 21,202,412 N83S probably benign Het
Gpr39 T C 1: 125,872,586 V358A probably damaging Het
Gsap A G 5: 21,226,325 R216G probably damaging Het
Gsap A T 5: 21,270,577 T570S probably benign Het
Gucy2d A T 7: 98,443,823 I136L probably benign Het
Hap1 A T 11: 100,349,392 V294E probably damaging Het
Ipo8 A G 6: 148,799,780 V514A probably damaging Het
Irf5 T C 6: 29,535,959 L324P probably damaging Het
Itsn1 C T 16: 91,816,852 R251C probably damaging Het
Klf11 T C 12: 24,651,568 probably null Het
Kpna6 G A 4: 129,649,306 Q439* probably null Het
Mark4 A T 7: 19,429,516 S563T probably benign Het
Mrpl21 A T 19: 3,283,084 I5L probably benign Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myrf G A 19: 10,212,475 T815I probably damaging Het
Olfr1211 C T 2: 88,930,253 V21I probably benign Het
Olfr515-ps1 A T 7: 108,844,971 probably null Het
Olfr665 A G 7: 104,881,082 Y125C possibly damaging Het
Olfr743 A G 14: 50,534,321 N303S probably benign Het
Olfr961 G T 9: 39,647,259 D178Y probably damaging Het
Os9 T C 10: 127,099,943 D280G probably benign Het
Pcdhb14 A G 18: 37,449,230 N463S probably damaging Het
Pex19 G A 1: 172,134,039 E271K probably damaging Het
Ppdpf G A 2: 181,187,848 S32N probably benign Het
Prdm2 A G 4: 143,132,907 I1271T probably benign Het
Rbbp4 T C 4: 129,321,958 T262A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sult1e1 A T 5: 87,579,911 S171T probably damaging Het
Tns1 T C 1: 73,953,453 T689A probably damaging Het
Unc13c G C 9: 73,693,366 N1365K probably benign Het
Vmn2r52 T C 7: 10,171,163 I250V probably benign Het
Vmn2r55 C A 7: 12,668,142 L406F probably benign Het
Wdcp T C 12: 4,850,621 V159A possibly damaging Het
Zbtb3 C T 19: 8,804,196 A391V probably benign Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Cd177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cd177 APN 7 24759751 missense possibly damaging 0.59
IGL00479:Cd177 APN 7 24758015 missense probably benign 0.05
IGL00673:Cd177 APN 7 24752017 missense possibly damaging 0.78
IGL00913:Cd177 APN 7 24756195 missense probably damaging 1.00
IGL01445:Cd177 APN 7 24752071 missense possibly damaging 0.95
IGL02021:Cd177 APN 7 24745206 missense probably benign 0.16
IGL02134:Cd177 APN 7 24752352 missense probably benign 0.01
IGL02532:Cd177 APN 7 24745249 missense probably benign 0.30
IGL02821:Cd177 APN 7 24744393 missense probably damaging 1.00
IGL02821:Cd177 APN 7 24744394 missense probably damaging 1.00
IGL02888:Cd177 APN 7 24758437 missense probably damaging 0.99
R0506:Cd177 UTSW 7 24758356 missense probably damaging 1.00
R0601:Cd177 UTSW 7 24752313 missense probably benign 0.00
R0631:Cd177 UTSW 7 24756686 missense probably benign 0.03
R0713:Cd177 UTSW 7 24744430 missense probably benign 0.25
R1595:Cd177 UTSW 7 24744964 missense probably benign
R1659:Cd177 UTSW 7 24746137 missense probably damaging 1.00
R2258:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2260:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2379:Cd177 UTSW 7 24758043 missense possibly damaging 0.80
R2763:Cd177 UTSW 7 24758037 missense probably benign 0.05
R2929:Cd177 UTSW 7 24754279 nonsense probably null
R3815:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3818:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3919:Cd177 UTSW 7 24744433 missense probably benign 0.15
R4300:Cd177 UTSW 7 24750420 missense possibly damaging 0.48
R4494:Cd177 UTSW 7 24752003 missense probably benign 0.06
R4781:Cd177 UTSW 7 24750626 missense probably damaging 1.00
R4819:Cd177 UTSW 7 24752271 missense probably damaging 1.00
R5062:Cd177 UTSW 7 24744316 missense probably benign 0.03
R5186:Cd177 UTSW 7 24744923 missense probably benign 0.31
R5285:Cd177 UTSW 7 24746249 missense probably benign 0.00
R5415:Cd177 UTSW 7 24752391 missense probably damaging 1.00
R5577:Cd177 UTSW 7 24745137 missense probably damaging 1.00
R5637:Cd177 UTSW 7 24756323 missense probably benign 0.01
R5673:Cd177 UTSW 7 24750362 missense probably damaging 1.00
R5731:Cd177 UTSW 7 24744421 missense probably damaging 1.00
R5775:Cd177 UTSW 7 24752268 missense probably damaging 1.00
R5840:Cd177 UTSW 7 24758070 missense probably damaging 0.99
R5870:Cd177 UTSW 7 24756332 missense probably benign 0.00
R5872:Cd177 UTSW 7 24752263 missense probably null 1.00
R6505:Cd177 UTSW 7 24744246 missense probably benign 0.00
R6897:Cd177 UTSW 7 24745074 missense probably benign 0.31
R7023:Cd177 UTSW 7 24759762 missense probably benign 0.44
R7088:Cd177 UTSW 7 24745133 nonsense probably null
R7188:Cd177 UTSW 7 24756647 missense probably damaging 1.00
R7366:Cd177 UTSW 7 24756722 missense probably damaging 1.00
R7744:Cd177 UTSW 7 24750375 missense probably damaging 1.00
R8008:Cd177 UTSW 7 24752349 missense not run
R8029:Cd177 UTSW 7 24756169 nonsense probably null
R8030:Cd177 UTSW 7 24756169 nonsense probably null
R8032:Cd177 UTSW 7 24756169 nonsense probably null
Z1176:Cd177 UTSW 7 24746171 missense not run
Z1177:Cd177 UTSW 7 24760256 missense not run
Predicted Primers PCR Primer
(F):5'- AACGTGTGCTTGTCTGCTC -3'
(R):5'- TACCAGAGTGAGCATTCAGGG -3'

Sequencing Primer
(F):5'- GTTCAGTGGCTCCCAAGTCTAAG -3'
(R):5'- ATTCAGGGGTGCATGGCC -3'
Posted On2017-10-10