Incidental Mutation 'R6148:Ano9'
ID489025
Institutional Source Beutler Lab
Gene Symbol Ano9
Ensembl Gene ENSMUSG00000054662
Gene Nameanoctamin 9
Synonyms5430425C04Rik, Tmem16j, Trp53i5, Tp53i5
MMRRC Submission 044295-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6148 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141101212-141117806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141106785 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 429 (Y429H)
Ref Sequence ENSEMBL: ENSMUSP00000067689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067836]
Predicted Effect probably damaging
Transcript: ENSMUST00000067836
AA Change: Y429H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: Y429H

DomainStartEndE-ValueType
Pfam:Anoctamin 174 730 3.3e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211515
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,187,426 C1067S possibly damaging Het
Agbl3 T A 6: 34,857,753 S952R possibly damaging Het
Bbs7 C A 3: 36,613,266 R7L probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Catsper4 A G 4: 134,217,929 V206A probably damaging Het
Ccdc73 T G 2: 104,992,137 S810R possibly damaging Het
Cd177 A T 7: 24,744,273 L800* probably null Het
Cd34 T C 1: 194,948,008 probably null Het
Cep78 G A 19: 15,981,786 R95* probably null Het
Cfap69 T C 5: 5,663,996 D12G probably benign Het
Cpne7 A G 8: 123,127,432 D286G probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cxcl5 A T 5: 90,759,706 I46L probably benign Het
Cyp19a1 C T 9: 54,180,256 G59D probably damaging Het
Dclre1c A G 2: 3,437,705 D35G probably damaging Het
Dvl1 A G 4: 155,854,952 Y279C probably damaging Het
Fes A G 7: 80,380,296 L578P probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fmn2 T C 1: 174,666,663 S1248P probably damaging Het
Fmo1 T G 1: 162,851,519 S53R probably damaging Het
Gabrg1 A T 5: 70,774,461 M313K probably damaging Het
Galnt10 T C 11: 57,784,648 C578R probably damaging Het
Gm13178 T C 4: 144,721,317 T30A possibly damaging Het
Gm15293 A G 8: 21,202,412 N83S probably benign Het
Gpr39 T C 1: 125,872,586 V358A probably damaging Het
Gsap A G 5: 21,226,325 R216G probably damaging Het
Gsap A T 5: 21,270,577 T570S probably benign Het
Gucy2d A T 7: 98,443,823 I136L probably benign Het
Hap1 A T 11: 100,349,392 V294E probably damaging Het
Ipo8 A G 6: 148,799,780 V514A probably damaging Het
Irf5 T C 6: 29,535,959 L324P probably damaging Het
Itsn1 C T 16: 91,816,852 R251C probably damaging Het
Klf11 T C 12: 24,651,568 probably null Het
Kpna6 G A 4: 129,649,306 Q439* probably null Het
Mark4 A T 7: 19,429,516 S563T probably benign Het
Mrpl21 A T 19: 3,283,084 I5L probably benign Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myrf G A 19: 10,212,475 T815I probably damaging Het
Olfr1211 C T 2: 88,930,253 V21I probably benign Het
Olfr515-ps1 A T 7: 108,844,971 probably null Het
Olfr665 A G 7: 104,881,082 Y125C possibly damaging Het
Olfr743 A G 14: 50,534,321 N303S probably benign Het
Olfr961 G T 9: 39,647,259 D178Y probably damaging Het
Os9 T C 10: 127,099,943 D280G probably benign Het
Pcdhb14 A G 18: 37,449,230 N463S probably damaging Het
Pex19 G A 1: 172,134,039 E271K probably damaging Het
Ppdpf G A 2: 181,187,848 S32N probably benign Het
Prdm2 A G 4: 143,132,907 I1271T probably benign Het
Rbbp4 T C 4: 129,321,958 T262A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sult1e1 A T 5: 87,579,911 S171T probably damaging Het
Tns1 T C 1: 73,953,453 T689A probably damaging Het
Unc13c G C 9: 73,693,366 N1365K probably benign Het
Vmn2r52 T C 7: 10,171,163 I250V probably benign Het
Vmn2r55 C A 7: 12,668,142 L406F probably benign Het
Wdcp T C 12: 4,850,621 V159A possibly damaging Het
Zbtb3 C T 19: 8,804,196 A391V probably benign Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Ano9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ano9 APN 7 141102042 nonsense probably null
IGL01620:Ano9 APN 7 141110439 missense probably damaging 1.00
IGL02045:Ano9 APN 7 141102469 missense probably benign 0.00
IGL02506:Ano9 APN 7 141102254 unclassified probably benign
IGL02657:Ano9 APN 7 141107440 missense probably damaging 1.00
IGL02731:Ano9 APN 7 141107204 missense probably damaging 1.00
IGL02863:Ano9 APN 7 141108651 missense probably benign 0.00
R0114:Ano9 UTSW 7 141103239 unclassified probably benign
R0374:Ano9 UTSW 7 141107814 missense probably damaging 0.98
R0487:Ano9 UTSW 7 141107849 missense possibly damaging 0.85
R0600:Ano9 UTSW 7 141104710 missense probably damaging 1.00
R0702:Ano9 UTSW 7 141107282 missense probably damaging 1.00
R0765:Ano9 UTSW 7 141107184 missense probably damaging 1.00
R1679:Ano9 UTSW 7 141108297 missense probably benign 0.03
R1773:Ano9 UTSW 7 141108378 missense possibly damaging 0.95
R1809:Ano9 UTSW 7 141108804 missense possibly damaging 0.93
R1883:Ano9 UTSW 7 141102331 missense probably benign
R2034:Ano9 UTSW 7 141108135 missense probably damaging 0.99
R2159:Ano9 UTSW 7 141108117 missense probably benign 0.01
R2254:Ano9 UTSW 7 141103090 missense probably benign
R2293:Ano9 UTSW 7 141102515 missense probably benign
R3177:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R3277:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R4274:Ano9 UTSW 7 141110695 missense probably benign
R4576:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4577:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4872:Ano9 UTSW 7 141107204 missense probably damaging 1.00
R4879:Ano9 UTSW 7 141110502 missense probably benign 0.23
R5160:Ano9 UTSW 7 141104365 missense probably damaging 1.00
R5560:Ano9 UTSW 7 141110482 missense probably damaging 1.00
R6302:Ano9 UTSW 7 141104308 missense probably damaging 1.00
R6821:Ano9 UTSW 7 141107256 missense possibly damaging 0.70
R7253:Ano9 UTSW 7 141107437 missense probably damaging 0.96
R7479:Ano9 UTSW 7 141102435 missense probably damaging 0.99
R7836:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R7919:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R8051:Ano9 UTSW 7 141104532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAATATATGAGTGCTCTGCTGC -3'
(R):5'- TGTGATCAAACATGGGGTGG -3'

Sequencing Primer
(F):5'- AGGGCATCGGATCCCTTTCTAAATG -3'
(R):5'- AAACATGGGGTGGGGGCTTC -3'
Posted On2017-10-10