Mutagenetix > Incidental Mutations

Incidental Mutation 'R6148:2700049A03Rik'

489037

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3

MMRRC Submission

044295-MU

Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6148 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71136848-71243303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71187426 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1067 (C1067S)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045907
AA Change: C1067S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: C1067S

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149564
AA Change: C1067S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: C1067S

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.6%

Validation Efficiency

95% (61/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl3	T	A	6: 34,857,753	S952R	possibly damaging	Het
Ano9	A	G	7: 141,106,785	Y429H	probably damaging	Het
Bbs7	C	A	3: 36,613,266	R7L	probably damaging	Het
Birc3	T	A	9: 7,849,683	D535V	possibly damaging	Het
Catsper4	A	G	4: 134,217,929	V206A	probably damaging	Het
Ccdc73	T	G	2: 104,992,137	S810R	possibly damaging	Het
Cd177	A	T	7: 24,744,273	L800*	probably null	Het
Cd34	T	C	1: 194,948,008		probably null	Het
Cep78	G	A	19: 15,981,786	R95*	probably null	Het
Cfap69	T	C	5: 5,663,996	D12G	probably benign	Het
Cpne7	A	G	8: 123,127,432	D286G	probably benign	Het
Cwc22	ATCTCTCTCTCTCTCTCT	ATCTCTCTCTCTCTCT	2: 77,929,459		probably null	Het
Cxcl5	A	T	5: 90,759,706	I46L	probably benign	Het
Cyp19a1	C	T	9: 54,180,256	G59D	probably damaging	Het
Dclre1c	A	G	2: 3,437,705	D35G	probably damaging	Het
Dvl1	A	G	4: 155,854,952	Y279C	probably damaging	Het
Fes	A	G	7: 80,380,296	L578P	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fmn2	T	C	1: 174,666,663	S1248P	probably damaging	Het
Fmo1	T	G	1: 162,851,519	S53R	probably damaging	Het
Gabrg1	A	T	5: 70,774,461	M313K	probably damaging	Het
Galnt10	T	C	11: 57,784,648	C578R	probably damaging	Het
Gm13178	T	C	4: 144,721,317	T30A	possibly damaging	Het
Gm15293	A	G	8: 21,202,412	N83S	probably benign	Het
Gpr39	T	C	1: 125,872,586	V358A	probably damaging	Het
Gsap	A	G	5: 21,226,325	R216G	probably damaging	Het
Gsap	A	T	5: 21,270,577	T570S	probably benign	Het
Gucy2d	A	T	7: 98,443,823	I136L	probably benign	Het
Hap1	A	T	11: 100,349,392	V294E	probably damaging	Het
Ipo8	A	G	6: 148,799,780	V514A	probably damaging	Het
Irf5	T	C	6: 29,535,959	L324P	probably damaging	Het
Itsn1	C	T	16: 91,816,852	R251C	probably damaging	Het
Klf11	T	C	12: 24,651,568		probably null	Het
Kpna6	G	A	4: 129,649,306	Q439*	probably null	Het
Mark4	A	T	7: 19,429,516	S563T	probably benign	Het
Mrpl21	A	T	19: 3,283,084	I5L	probably benign	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Myrf	G	A	19: 10,212,475	T815I	probably damaging	Het
Olfr1211	C	T	2: 88,930,253	V21I	probably benign	Het
Olfr515-ps1	A	T	7: 108,844,971		probably null	Het
Olfr665	A	G	7: 104,881,082	Y125C	possibly damaging	Het
Olfr743	A	G	14: 50,534,321	N303S	probably benign	Het
Olfr961	G	T	9: 39,647,259	D178Y	probably damaging	Het
Os9	T	C	10: 127,099,943	D280G	probably benign	Het
Pcdhb14	A	G	18: 37,449,230	N463S	probably damaging	Het
Pex19	G	A	1: 172,134,039	E271K	probably damaging	Het
Ppdpf	G	A	2: 181,187,848	S32N	probably benign	Het
Prdm2	A	G	4: 143,132,907	I1271T	probably benign	Het
Rbbp4	T	C	4: 129,321,958	T262A	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Sult1e1	A	T	5: 87,579,911	S171T	probably damaging	Het
Tns1	T	C	1: 73,953,453	T689A	probably damaging	Het
Unc13c	G	C	9: 73,693,366	N1365K	probably benign	Het
Vmn2r52	T	C	7: 10,171,163	I250V	probably benign	Het
Vmn2r55	C	A	7: 12,668,142	L406F	probably benign	Het
Wdcp	T	C	12: 4,850,621	V159A	possibly damaging	Het
Zbtb3	C	T	19: 8,804,196	A391V	probably benign	Het
Znhit1	A	T	5: 136,982,633	S109T	probably benign	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71167119	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71194468	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71164378	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71167181	nonsense	probably null
IGL01835:2700049A03Rik	APN	12	71167183	missense	probably benign	0.00
IGL02122:2700049A03Rik	APN	12	71170525	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71148260	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71154856	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71193373	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71140883	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71158825	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71137909	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71160386	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71170666	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71177918	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71167150	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71148420	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71138030	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71193310	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71164388	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71177868	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71158883	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71219308	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71216144	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71170587	unclassified	probably null
R1599:2700049A03Rik	UTSW	12	71150259	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71219221	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71150244	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71160412	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71188619	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2337:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2512:2700049A03Rik	UTSW	12	71173171	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71154756	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3236:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3808:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71148263	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4651:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4735:2700049A03Rik	UTSW	12	71216123	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71189442	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4852:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4855:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4884:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71189646	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71243025	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71193349	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71188791	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71243027	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5502:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5671:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5725:2700049A03Rik	UTSW	12	71193319	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71157119	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71184530	missense	possibly damaging	0.84
R6158:2700049A03Rik	UTSW	12	71170636	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71164544	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71216230	intron	probably null
R7168:2700049A03Rik	UTSW	12	71216057	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71219189	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71140906	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71189574	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71150405	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTTAAGCCCCAGAGCACGAAG -3'
(R):5'- CCTCAGCAAGTCAAGCACTG -3'

Sequencing Primer
(F):5'- CCAGAGCACGAAGGCTTTTC -3'
(R):5'- TCAGCAAGTCAAGCACTGTTAAAG -3'

Posted On

2017-10-10