Incidental Mutation 'R6148:Mrpl21'
ID489042
Institutional Source Beutler Lab
Gene Symbol Mrpl21
Ensembl Gene ENSMUSG00000024829
Gene Namemitochondrial ribosomal protein L21
Synonyms
MMRRC Submission 044295-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R6148 (G1)
Quality Score128.008
Status Validated
Chromosome19
Chromosomal Location3282901-3292837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3283084 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 5 (I5L)
Ref Sequence ENSEMBL: ENSMUSP00000120330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025743] [ENSMUST00000025745] [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000141610] [ENSMUST00000154537]
Predicted Effect unknown
Transcript: ENSMUST00000025743
AA Change: I5L
SMART Domains Protein: ENSMUSP00000025743
Gene: ENSMUSG00000024829
AA Change: I5L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Ribosomal_L21p 99 197 7.5e-25 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000025745
AA Change: I5L
SMART Domains Protein: ENSMUSP00000025745
Gene: ENSMUSG00000024829
AA Change: I5L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Ribosomal_L21p 99 192 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025751
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119292
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139844
Predicted Effect probably benign
Transcript: ENSMUST00000141610
AA Change: I5L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120330
Gene: ENSMUSG00000024829
AA Change: I5L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:4CE4|V 14 53 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155870
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 95% (61/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding different isoforms were identified through sequence analysis although some may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,187,426 C1067S possibly damaging Het
Agbl3 T A 6: 34,857,753 S952R possibly damaging Het
Ano9 A G 7: 141,106,785 Y429H probably damaging Het
Bbs7 C A 3: 36,613,266 R7L probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Catsper4 A G 4: 134,217,929 V206A probably damaging Het
Ccdc73 T G 2: 104,992,137 S810R possibly damaging Het
Cd177 A T 7: 24,744,273 L800* probably null Het
Cd34 T C 1: 194,948,008 probably null Het
Cep78 G A 19: 15,981,786 R95* probably null Het
Cfap69 T C 5: 5,663,996 D12G probably benign Het
Cpne7 A G 8: 123,127,432 D286G probably benign Het
Cwc22 ATCTCTCTCTCTCTCTCT ATCTCTCTCTCTCTCT 2: 77,929,459 probably null Het
Cxcl5 A T 5: 90,759,706 I46L probably benign Het
Cyp19a1 C T 9: 54,180,256 G59D probably damaging Het
Dclre1c A G 2: 3,437,705 D35G probably damaging Het
Dvl1 A G 4: 155,854,952 Y279C probably damaging Het
Fes A G 7: 80,380,296 L578P probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fmn2 T C 1: 174,666,663 S1248P probably damaging Het
Fmo1 T G 1: 162,851,519 S53R probably damaging Het
Gabrg1 A T 5: 70,774,461 M313K probably damaging Het
Galnt10 T C 11: 57,784,648 C578R probably damaging Het
Gm13178 T C 4: 144,721,317 T30A possibly damaging Het
Gm15293 A G 8: 21,202,412 N83S probably benign Het
Gpr39 T C 1: 125,872,586 V358A probably damaging Het
Gsap A G 5: 21,226,325 R216G probably damaging Het
Gsap A T 5: 21,270,577 T570S probably benign Het
Gucy2d A T 7: 98,443,823 I136L probably benign Het
Hap1 A T 11: 100,349,392 V294E probably damaging Het
Ipo8 A G 6: 148,799,780 V514A probably damaging Het
Irf5 T C 6: 29,535,959 L324P probably damaging Het
Itsn1 C T 16: 91,816,852 R251C probably damaging Het
Klf11 T C 12: 24,651,568 probably null Het
Kpna6 G A 4: 129,649,306 Q439* probably null Het
Mark4 A T 7: 19,429,516 S563T probably benign Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myrf G A 19: 10,212,475 T815I probably damaging Het
Olfr1211 C T 2: 88,930,253 V21I probably benign Het
Olfr515-ps1 A T 7: 108,844,971 probably null Het
Olfr665 A G 7: 104,881,082 Y125C possibly damaging Het
Olfr743 A G 14: 50,534,321 N303S probably benign Het
Olfr961 G T 9: 39,647,259 D178Y probably damaging Het
Os9 T C 10: 127,099,943 D280G probably benign Het
Pcdhb14 A G 18: 37,449,230 N463S probably damaging Het
Pex19 G A 1: 172,134,039 E271K probably damaging Het
Ppdpf G A 2: 181,187,848 S32N probably benign Het
Prdm2 A G 4: 143,132,907 I1271T probably benign Het
Rbbp4 T C 4: 129,321,958 T262A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Sult1e1 A T 5: 87,579,911 S171T probably damaging Het
Tns1 T C 1: 73,953,453 T689A probably damaging Het
Unc13c G C 9: 73,693,366 N1365K probably benign Het
Vmn2r52 T C 7: 10,171,163 I250V probably benign Het
Vmn2r55 C A 7: 12,668,142 L406F probably benign Het
Wdcp T C 12: 4,850,621 V159A possibly damaging Het
Zbtb3 C T 19: 8,804,196 A391V probably benign Het
Znhit1 A T 5: 136,982,633 S109T probably benign Het
Other mutations in Mrpl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Mrpl21 APN 19 3292529 unclassified probably benign
R0079:Mrpl21 UTSW 19 3284807 missense possibly damaging 0.50
R0410:Mrpl21 UTSW 19 3284792 missense possibly damaging 0.83
R0449:Mrpl21 UTSW 19 3292459 unclassified probably benign
R1458:Mrpl21 UTSW 19 3284808 missense possibly damaging 0.75
R4229:Mrpl21 UTSW 19 3286901 missense probably damaging 0.98
R5269:Mrpl21 UTSW 19 3287012 missense probably damaging 1.00
R5327:Mrpl21 UTSW 19 3287009 unclassified probably null
R6708:Mrpl21 UTSW 19 3286890 missense probably damaging 1.00
R7219:Mrpl21 UTSW 19 3286998 missense probably benign 0.02
R7840:Mrpl21 UTSW 19 3287752 missense probably damaging 1.00
R7923:Mrpl21 UTSW 19 3287752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATCCGCAAAAGGCCCTG -3'
(R):5'- CCCTGTGCCATATTCACGAC -3'

Sequencing Primer
(F):5'- AAAAGGCCCTGCGCTCC -3'
(R):5'- GTGCCATATTCACGACTCTCATAAC -3'
Posted On2017-10-10