Incidental Mutation 'R6149:Prpf40a'
ID489053
Institutional Source Beutler Lab
Gene Symbol Prpf40a
Ensembl Gene ENSMUSG00000061136
Gene Namepre-mRNA processing factor 40A
SynonymsFnbp3, FBP11, 2810012K09Rik
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location53134704-53191284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53157915 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 197 (M197V)
Ref Sequence ENSEMBL: ENSMUSP00000147599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076313] [ENSMUST00000125243] [ENSMUST00000209364] [ENSMUST00000209508] [ENSMUST00000210789] [ENSMUST00000211102] [ENSMUST00000211712]
Predicted Effect probably benign
Transcript: ENSMUST00000076313
AA Change: M239V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075655
Gene: ENSMUSG00000061136
AA Change: M239V

DomainStartEndE-ValueType
low complexity region 77 124 N/A INTRINSIC
WW 141 173 7.54e-13 SMART
WW 182 214 1.57e-10 SMART
low complexity region 272 294 N/A INTRINSIC
FF 389 443 1.32e-17 SMART
FF 456 515 4.22e1 SMART
FF 523 583 1.11e-10 SMART
FF 603 663 4.31e0 SMART
low complexity region 670 682 N/A INTRINSIC
FF 739 795 7.43e-12 SMART
low complexity region 802 879 N/A INTRINSIC
low complexity region 883 923 N/A INTRINSIC
low complexity region 929 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125243
SMART Domains Protein: ENSMUSP00000117406
Gene: ENSMUSG00000061136

DomainStartEndE-ValueType
low complexity region 35 82 N/A INTRINSIC
WW 99 131 7.54e-13 SMART
WW 140 172 1.57e-10 SMART
low complexity region 230 252 N/A INTRINSIC
FF 347 401 1.32e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209364
AA Change: M212V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000209508
Predicted Effect probably benign
Transcript: ENSMUST00000210789
AA Change: M197V

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000211102
Predicted Effect probably benign
Transcript: ENSMUST00000211712
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Prpf40a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Prpf40a APN 2 53150688 missense probably benign 0.00
IGL00533:Prpf40a APN 2 53145343 missense probably damaging 1.00
IGL01099:Prpf40a APN 2 53141835 missense probably benign 0.00
IGL02039:Prpf40a APN 2 53144803 missense probably damaging 1.00
IGL02608:Prpf40a APN 2 53146153 missense probably damaging 0.97
I1329:Prpf40a UTSW 2 53176395 missense probably benign 0.01
R0284:Prpf40a UTSW 2 53150647 missense probably damaging 1.00
R0401:Prpf40a UTSW 2 53159313 missense probably damaging 0.99
R0544:Prpf40a UTSW 2 53141651 unclassified probably benign
R0582:Prpf40a UTSW 2 53145692 missense probably damaging 1.00
R1533:Prpf40a UTSW 2 53145840 missense probably damaging 1.00
R2057:Prpf40a UTSW 2 53144839 missense probably damaging 1.00
R4274:Prpf40a UTSW 2 53146172 missense probably damaging 1.00
R4604:Prpf40a UTSW 2 53142023 missense probably damaging 0.99
R4814:Prpf40a UTSW 2 53190020 missense probably damaging 1.00
R4976:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5119:Prpf40a UTSW 2 53144849 missense probably damaging 1.00
R5378:Prpf40a UTSW 2 53145876 missense probably damaging 1.00
R5448:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5449:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5450:Prpf40a UTSW 2 53156926 missense possibly damaging 0.63
R5500:Prpf40a UTSW 2 53145284 missense probably benign 0.03
R5637:Prpf40a UTSW 2 53156734 missense possibly damaging 0.59
R6052:Prpf40a UTSW 2 53159281 missense probably benign 0.41
R6150:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6151:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6162:Prpf40a UTSW 2 53159305 missense probably benign 0.01
R6199:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6200:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6207:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6254:Prpf40a UTSW 2 53157915 missense probably benign 0.07
R6266:Prpf40a UTSW 2 53156627 missense probably benign 0.17
R6394:Prpf40a UTSW 2 53144878 missense probably damaging 1.00
R6603:Prpf40a UTSW 2 53152963 missense probably damaging 0.96
R6606:Prpf40a UTSW 2 53151751 missense probably damaging 0.99
R6641:Prpf40a UTSW 2 53141626 unclassified probably benign
R6929:Prpf40a UTSW 2 53144863 missense possibly damaging 0.95
R7158:Prpf40a UTSW 2 53152553 missense probably damaging 0.99
R7401:Prpf40a UTSW 2 53156947 missense probably benign 0.01
R7675:Prpf40a UTSW 2 53145636 missense possibly damaging 0.89
R7750:Prpf40a UTSW 2 53151745 missense probably damaging 1.00
R7893:Prpf40a UTSW 2 53156841 missense probably benign 0.24
R7976:Prpf40a UTSW 2 53156841 missense probably benign 0.24
R8027:Prpf40a UTSW 2 53191138 missense not run
X0060:Prpf40a UTSW 2 53145664 missense probably damaging 0.96
Z1176:Prpf40a UTSW 2 53144875 missense not run
Predicted Primers PCR Primer
(F):5'- TCGTAAGGCTCAGGAAGTCAAG -3'
(R):5'- TTGCATTGAGGCTTTGAAACTC -3'

Sequencing Primer
(F):5'- CAACATACGCAAGGCTGTGGTTC -3'
(R):5'- TGAGGCTTTGAAACTCAAGTAAATAC -3'
Posted On2017-10-10