Mutagenetix > Incidental Mutation

Incidental Mutation 'R6149:Frem2'

489056

Institutional Source

Beutler Lab

Gene Symbol

Frem2

Ensembl Gene

ENSMUSG00000037016

Gene Name

Fras1 related extracellular matrix protein 2

Synonyms

my, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik

MMRRC Submission

044296-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53513938-53657355 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53551341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 2036 (S2036T)

Ref Sequence

ENSEMBL: ENSMUSP00000088670 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091137]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091137
AA Change: S2036T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: S2036T

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
Pfam:Cadherin_3	249	388	4.3e-9	PFAM
Pfam:Cadherin_3	376	532	3e-34	PFAM
Pfam:Cadherin_3	516	665	7.5e-24	PFAM
Pfam:Cadherin_3	632	798	1.6e-21	PFAM
Pfam:Cadherin_3	763	910	1.2e-25	PFAM
Pfam:Cadherin_3	879	1027	5.1e-18	PFAM
Pfam:Cadherin_3	1015	1159	2.2e-20	PFAM
CA	1202	1293	4.8e-1	SMART
Pfam:Cadherin_3	1392	1503	9.8e-24	PFAM
Pfam:Cadherin_3	1504	1612	6.2e-28	PFAM
Pfam:Cadherin_3	1613	1743	5.3e-20	PFAM
Calx_beta	1748	1847	1.5e-5	SMART
Calx_beta	1860	1971	9.47e-12	SMART
Calx_beta	1985	2092	1.65e-11	SMART
Calx_beta	2105	2209	1.99e-5	SMART
Calx_beta	2227	2331	6.9e-14	SMART
transmembrane domain	3103	3125	N/A	INTRINSIC

Meta Mutation Damage Score

0.1492

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930558K02Rik	T	A	1: 161,949,642	R115S	probably benign	Het
Adgre1	A	G	17: 57,445,018	K589E	probably benign	Het
Adgrv1	A	T	13: 81,182,774	L74Q	probably damaging	Het
Avil	A	G	10: 127,006,582	I77V	probably benign	Het
Best2	T	C	8: 85,013,267	E57G	probably benign	Het
C87977	A	G	4: 144,207,413	S375P	probably damaging	Het
Cacna1a	T	C	8: 84,569,952	C1200R	probably damaging	Het
Catsperb	T	A	12: 101,549,839	I578K	probably damaging	Het
Chsy1	A	G	7: 66,125,385	Y154C	probably damaging	Het
Chuk	A	G	19: 44,101,831	V74A	probably damaging	Het
Ckb	T	C	12: 111,671,814	S49G	probably damaging	Het
Crtac1	A	G	19: 42,283,609	Y632H	unknown	Het
Ern1	C	A	11: 106,405,815	E770*	probably null	Het
Fam114a2	A	C	11: 57,487,589	V450G	probably benign	Het
Fgf15	C	T	7: 144,899,769	Q125*	probably null	Het
Fxr2	G	A	11: 69,649,204	V296I	probably benign	Het
Gm15264	C	A	3: 94,733,429		noncoding transcript	Het
Gm340	T	A	19: 41,585,202	W799R	probably damaging	Het
Ifi213	A	T	1: 173,594,015	S103T	probably benign	Het
Igkv5-37	T	A	6: 69,963,488	Q57H	probably damaging	Het
Il1rap	A	G	16: 26,712,219	Y435C	probably damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Lnp1	C	T	16: 56,917,372	E118K	probably benign	Het
Lrif1	A	C	3: 106,732,327	K243Q	possibly damaging	Het
Lrp1b	G	T	2: 40,875,153		probably null	Het
Lvrn	G	A	18: 46,884,432	V610I	probably benign	Het
Med1	T	C	11: 98,183,853	K67R	possibly damaging	Het
Midn	T	C	10: 80,154,457	S278P	probably damaging	Het
Nrap	A	G	19: 56,389,453	V35A	possibly damaging	Het
Nynrin	A	T	14: 55,854,323	Q32L	possibly damaging	Het
Olfr1265	C	T	2: 90,037,516	A199V	probably benign	Het
Olfr1328	A	G	4: 118,934,431	L139P	probably damaging	Het
Olfr1444	A	T	19: 12,862,359	I195F	probably benign	Het
Olfr2	T	C	7: 107,001,600	I87V	probably benign	Het
Olfr218	G	T	1: 173,204,015	V220F	probably benign	Het
Oog1	C	T	12: 87,606,273	T113I	possibly damaging	Het
Otogl	C	T	10: 107,881,453	V386I	probably benign	Het
Patj	A	G	4: 98,424,325	N300S	possibly damaging	Het
Pcdhb16	T	A	18: 37,479,155	D389E	possibly damaging	Het
Pdcd6ip	T	C	9: 113,659,871	I699V	probably benign	Het
Pfas	A	G	11: 68,991,945	V790A	probably benign	Het
Plppr4	A	T	3: 117,322,394	C605S	probably benign	Het
Ppl	G	A	16: 5,107,596	Q60*	probably null	Het
Ppp1r1c	A	G	2: 79,756,466	K52R	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rpe65	G	A	3: 159,614,143	E217K	probably benign	Het
Rufy4	T	C	1: 74,147,733	I560T	probably benign	Het
Ryr2	T	C	13: 11,669,017	S3054G	probably benign	Het
Serpinb6a	A	T	13: 33,918,360	L273H	probably damaging	Het
Sf3b1	A	T	1: 55,007,507	W293R	probably damaging	Het
Sik1	A	T	17: 31,848,797	S435T	possibly damaging	Het
Slc2a12	G	T	10: 22,664,502	M85I	probably benign	Het
Stk36	T	C	1: 74,634,229	S1094P	probably benign	Het
Tctn1	A	T	5: 122,246,586	Y393N	probably benign	Het
Tex9	C	T	9: 72,462,000		probably null	Het
Thbs2	A	G	17: 14,679,680		probably null	Het
Tmprss7	A	T	16: 45,673,905	C412*	probably null	Het
Tpp1	T	C	7: 105,747,727	T399A	probably benign	Het
Trim25	T	A	11: 89,015,536	V387D	probably benign	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vill	T	G	9: 119,058,414	V82G	possibly damaging	Het
Vmn1r189	T	C	13: 22,101,884	D261G	probably benign	Het
Vmn2r111	G	A	17: 22,548,815	T567I	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r60	A	G	7: 42,136,976	Y401C	probably damaging	Het
Zc3h11a	G	A	1: 133,638,875	R69*	probably null	Het

Other mutations in Frem2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Frem2	APN	3	53585595	missense	probably damaging	1.00
IGL00911:Frem2	APN	3	53572462	missense	probably damaging	1.00
IGL01322:Frem2	APN	3	53541038	missense	probably benign	0.00
IGL01330:Frem2	APN	3	53655241	missense	possibly damaging	0.70
IGL01406:Frem2	APN	3	53525896	missense	probably damaging	1.00
IGL01556:Frem2	APN	3	53535281	missense	probably benign	0.23
IGL01580:Frem2	APN	3	53655175	missense	probably damaging	1.00
IGL01606:Frem2	APN	3	53653591	missense	possibly damaging	0.69
IGL01611:Frem2	APN	3	53655709	missense	probably benign	0.00
IGL01648:Frem2	APN	3	53535732	missense	possibly damaging	0.86
IGL01663:Frem2	APN	3	53517013	missense	probably damaging	1.00
IGL01665:Frem2	APN	3	53549662	missense	probably benign	0.07
IGL01670:Frem2	APN	3	53656937	missense	possibly damaging	0.95
IGL01960:Frem2	APN	3	53522304	missense	probably benign	0.33
IGL02175:Frem2	APN	3	53655599	missense	possibly damaging	0.69
IGL02201:Frem2	APN	3	53519640	missense	probably benign	0.35
IGL02202:Frem2	APN	3	53654799	missense	probably benign	0.00
IGL02427:Frem2	APN	3	53535763	missense	probably damaging	0.97
IGL02457:Frem2	APN	3	53521049	missense	probably damaging	0.99
IGL02638:Frem2	APN	3	53551346	missense	possibly damaging	0.94
IGL02801:Frem2	APN	3	53652175	missense	possibly damaging	0.85
IGL03023:Frem2	APN	3	53655628	missense	probably benign	0.40
IGL03169:Frem2	APN	3	53522292	missense	probably benign	0.01
IGL03238:Frem2	APN	3	53656261	missense	possibly damaging	0.93
IGL03251:Frem2	APN	3	53572308	missense	probably benign	0.01
IGL03273:Frem2	APN	3	53537509	nonsense	probably null
IGL03343:Frem2	APN	3	53652253	missense	probably damaging	1.00
Biosimilar	UTSW	3	53654323	missense	probably benign	0.01
Fruit_stripe	UTSW	3	53537489	missense	probably benign	0.21
PIT4366001:Frem2	UTSW	3	53653201	missense	probably damaging	0.98
R0019:Frem2	UTSW	3	53523678	missense	probably damaging	0.99
R0092:Frem2	UTSW	3	53589796	missense	probably benign	0.03
R0108:Frem2	UTSW	3	53647961	missense	probably benign	0.03
R0115:Frem2	UTSW	3	53656208	missense	probably damaging	0.99
R0118:Frem2	UTSW	3	53535243	nonsense	probably null
R0374:Frem2	UTSW	3	53653960	missense	probably damaging	1.00
R0437:Frem2	UTSW	3	53653015	missense	possibly damaging	0.96
R0531:Frem2	UTSW	3	53519954	missense	probably damaging	1.00
R0555:Frem2	UTSW	3	53516860	missense	probably damaging	0.97
R0564:Frem2	UTSW	3	53656109	missense	probably damaging	0.97
R0586:Frem2	UTSW	3	53647921	missense	probably damaging	0.99
R0726:Frem2	UTSW	3	53519626	missense	possibly damaging	0.89
R0925:Frem2	UTSW	3	53653973	missense	probably benign
R1233:Frem2	UTSW	3	53547778	missense	probably damaging	0.98
R1302:Frem2	UTSW	3	53655538	missense	probably benign	0.00
R1333:Frem2	UTSW	3	53549731	missense	probably benign	0.26
R1446:Frem2	UTSW	3	53654596	missense	probably benign	0.31
R1523:Frem2	UTSW	3	53655407	missense	possibly damaging	0.73
R1539:Frem2	UTSW	3	53654210	missense	probably benign	0.19
R1543:Frem2	UTSW	3	53572455	missense	possibly damaging	0.86
R1597:Frem2	UTSW	3	53654519	missense	probably benign	0.19
R1600:Frem2	UTSW	3	53547723	missense	probably damaging	1.00
R1678:Frem2	UTSW	3	53519938	missense	probably damaging	1.00
R1687:Frem2	UTSW	3	53653952	missense	probably benign
R1696:Frem2	UTSW	3	53656042	nonsense	probably null
R1758:Frem2	UTSW	3	53653357	missense	probably damaging	1.00
R1857:Frem2	UTSW	3	53654873	missense	probably benign	0.10
R1869:Frem2	UTSW	3	53535196	missense	probably benign	0.04
R1921:Frem2	UTSW	3	53653495	missense	possibly damaging	0.76
R1973:Frem2	UTSW	3	53652232	missense	probably benign	0.01
R2045:Frem2	UTSW	3	53535744	missense	probably damaging	1.00
R2113:Frem2	UTSW	3	53652922	missense	probably damaging	1.00
R2152:Frem2	UTSW	3	53517029	nonsense	probably null
R2164:Frem2	UTSW	3	53537330	missense	probably damaging	1.00
R2181:Frem2	UTSW	3	53574587	missense	possibly damaging	0.72
R2201:Frem2	UTSW	3	53516573	missense	probably benign
R2221:Frem2	UTSW	3	53516857	missense	probably benign	0.00
R2255:Frem2	UTSW	3	53652514	missense	probably damaging	0.96
R2280:Frem2	UTSW	3	53572423	missense	probably damaging	1.00
R3196:Frem2	UTSW	3	53537331	missense	probably damaging	1.00
R3716:Frem2	UTSW	3	53572360	missense	probably damaging	1.00
R3807:Frem2	UTSW	3	53653449	missense	probably benign	0.22
R3820:Frem2	UTSW	3	53516849	missense	probably damaging	1.00
R3821:Frem2	UTSW	3	53652415	missense	probably damaging	1.00
R3977:Frem2	UTSW	3	53652070	missense	probably benign	0.00
R3979:Frem2	UTSW	3	53652070	missense	probably benign	0.00
R4014:Frem2	UTSW	3	53652353	missense	probably benign	0.01
R4127:Frem2	UTSW	3	53525896	missense	probably damaging	1.00
R4195:Frem2	UTSW	3	53539268	missense	possibly damaging	0.90
R4196:Frem2	UTSW	3	53539268	missense	possibly damaging	0.90
R4374:Frem2	UTSW	3	53545502	missense	possibly damaging	0.61
R4427:Frem2	UTSW	3	53539162	critical splice donor site	probably null
R4428:Frem2	UTSW	3	53654338	missense	probably benign	0.40
R4559:Frem2	UTSW	3	53654321	missense	probably benign	0.01
R4600:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4602:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4610:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4611:Frem2	UTSW	3	53547807	missense	possibly damaging	0.96
R4661:Frem2	UTSW	3	53655443	missense	probably damaging	1.00
R4678:Frem2	UTSW	3	53544371	missense	probably benign	0.00
R4689:Frem2	UTSW	3	53547635	missense	probably benign	0.43
R4740:Frem2	UTSW	3	53535819	missense	probably benign	0.04
R4748:Frem2	UTSW	3	53541093	missense	probably damaging	1.00
R4790:Frem2	UTSW	3	53516741	missense	probably benign
R4809:Frem2	UTSW	3	53653895	missense	probably benign	0.01
R4930:Frem2	UTSW	3	53656315	missense	possibly damaging	0.93
R4971:Frem2	UTSW	3	53539183	missense	probably damaging	1.00
R5057:Frem2	UTSW	3	53535196	missense	probably benign	0.37
R5202:Frem2	UTSW	3	53551346	missense	probably benign	0.41
R5221:Frem2	UTSW	3	53585611	missense	probably damaging	1.00
R5231:Frem2	UTSW	3	53522295	missense	probably damaging	1.00
R5268:Frem2	UTSW	3	53653154	missense	probably damaging	0.96
R5480:Frem2	UTSW	3	53656507	nonsense	probably null
R5637:Frem2	UTSW	3	53652937	missense	probably damaging	0.97
R5664:Frem2	UTSW	3	53652490	missense	probably benign	0.33
R5698:Frem2	UTSW	3	53652505	missense	possibly damaging	0.89
R5744:Frem2	UTSW	3	53655959	missense	probably damaging	1.00
R5754:Frem2	UTSW	3	53537258	missense	probably damaging	1.00
R5808:Frem2	UTSW	3	53652563	missense	probably damaging	0.96
R5840:Frem2	UTSW	3	53647921	missense	probably damaging	0.99
R5874:Frem2	UTSW	3	53537489	missense	probably benign	0.21
R6050:Frem2	UTSW	3	53653012	missense	probably damaging	0.99
R6103:Frem2	UTSW	3	53549788	missense	probably benign	0.00
R6182:Frem2	UTSW	3	53647969	missense	probably damaging	1.00
R6191:Frem2	UTSW	3	53655280	missense	probably benign	0.10
R6245:Frem2	UTSW	3	53655824	missense	probably benign	0.00
R6252:Frem2	UTSW	3	53572448	missense	probably damaging	1.00
R6393:Frem2	UTSW	3	53585640	missense	possibly damaging	0.91
R6416:Frem2	UTSW	3	53572378	missense	probably benign	0.01
R6595:Frem2	UTSW	3	53549784	missense	probably damaging	1.00
R6665:Frem2	UTSW	3	53654656	missense	probably damaging	1.00
R6708:Frem2	UTSW	3	53585501	missense	probably benign	0.00
R6751:Frem2	UTSW	3	53653665	missense	probably damaging	1.00
R6787:Frem2	UTSW	3	53654323	missense	probably benign	0.01
R6913:Frem2	UTSW	3	53516821	missense	probably damaging	1.00
R6916:Frem2	UTSW	3	53547688	missense	probably damaging	1.00
R7017:Frem2	UTSW	3	53519602	missense	probably benign	0.02
R7083:Frem2	UTSW	3	53537493	missense	probably damaging	0.99
R7108:Frem2	UTSW	3	53653513	missense	probably damaging	1.00
R7133:Frem2	UTSW	3	53572339	missense	possibly damaging	0.82
R7326:Frem2	UTSW	3	53654753	missense	probably damaging	1.00
R7341:Frem2	UTSW	3	53654495	missense	probably damaging	1.00
R7455:Frem2	UTSW	3	53572280	splice site	probably null
R7487:Frem2	UTSW	3	53654549	missense	probably benign	0.40
R7495:Frem2	UTSW	3	53516837	missense	probably benign	0.13
R7542:Frem2	UTSW	3	53652579	missense	probably damaging	1.00
R7636:Frem2	UTSW	3	53653247	missense	probably benign	0.00
R7703:Frem2	UTSW	3	53522168	missense	probably benign	0.01
R7750:Frem2	UTSW	3	53523682	missense	possibly damaging	0.83
R7849:Frem2	UTSW	3	53572374	missense	probably damaging	1.00
R7922:Frem2	UTSW	3	53653304	missense	probably damaging	0.98
R8008:Frem2	UTSW	3	53652910	missense	probably damaging	1.00
R8051:Frem2	UTSW	3	53535355	missense	probably benign	0.04
R8052:Frem2	UTSW	3	53549643	missense	probably benign	0.02
R8176:Frem2	UTSW	3	53655340	missense	possibly damaging	0.50
R8220:Frem2	UTSW	3	53656507	nonsense	probably null
R8397:Frem2	UTSW	3	53653141	missense	probably benign	0.00
R8410:Frem2	UTSW	3	53539177	missense	possibly damaging	0.60
R8697:Frem2	UTSW	3	53525828	missense	probably damaging	0.99
R9134:Frem2	UTSW	3	53654900	missense	probably damaging	1.00
R9183:Frem2	UTSW	3	53520065	missense	probably damaging	1.00
R9260:Frem2	UTSW	3	53652783	missense	probably damaging	1.00
R9267:Frem2	UTSW	3	53657083	start codon destroyed	probably null	0.00
R9299:Frem2	UTSW	3	53656559	missense	probably benign	0.37
R9378:Frem2	UTSW	3	53651989	missense	probably damaging	0.99
R9444:Frem2	UTSW	3	53652844	missense	probably benign	0.10
R9459:Frem2	UTSW	3	53653486	missense	probably benign
R9487:Frem2	UTSW	3	53653484	missense	possibly damaging	0.95
R9728:Frem2	UTSW	3	53656631	missense	probably benign	0.00
R9759:Frem2	UTSW	3	53655497	missense	possibly damaging	0.76
Z1177:Frem2	UTSW	3	53535166	missense	probably null	1.00
Z1177:Frem2	UTSW	3	53655607	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TCTGGCTCACGATTCTGATG -3'
(R):5'- GTCATGTGCGTCATCTCAGG -3'

Sequencing Primer
(F):5'- GCTCACGATTCTGATGTTACAACGG -3'
(R):5'- TCATCTCAGGGGCAGAGG -3'

Posted On

2017-10-10