Incidental Mutation 'R6149:Lrif1'
ID489057
Institutional Source Beutler Lab
Gene Symbol Lrif1
Ensembl Gene ENSMUSG00000056260
Gene Nameligand dependent nuclear receptor interacting factor 1
Synonyms2010012G17Rik, 4933421E11Rik
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location106684987-106736577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 106732327 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 243 (K243Q)
Ref Sequence ENSEMBL: ENSMUSP00000096346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098750] [ENSMUST00000098751] [ENSMUST00000106736] [ENSMUST00000127003] [ENSMUST00000130105] [ENSMUST00000150513] [ENSMUST00000154973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098750
AA Change: K243Q

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096346
Gene: ENSMUSG00000056260
AA Change: K243Q

DomainStartEndE-ValueType
Pfam:LRIF1 22 753 1.7e-292 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098751
SMART Domains Protein: ENSMUSP00000096347
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
coiled coil region 225 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106736
SMART Domains Protein: ENSMUSP00000102347
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 84 97 N/A INTRINSIC
coiled coil region 205 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106737
SMART Domains Protein: ENSMUSP00000102348
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
Pfam:LRIF1 22 347 6.2e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122928
Predicted Effect possibly damaging
Transcript: ENSMUST00000127003
AA Change: K243Q

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114163
Gene: ENSMUSG00000056260
AA Change: K243Q

DomainStartEndE-ValueType
low complexity region 74 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130105
SMART Domains Protein: ENSMUSP00000115110
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150513
SMART Domains Protein: ENSMUSP00000119815
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150888
Predicted Effect probably benign
Transcript: ENSMUST00000154973
SMART Domains Protein: ENSMUSP00000120350
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194058
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Lrif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Lrif1 APN 3 106734641 critical splice donor site probably null
IGL01121:Lrif1 APN 3 106735664 nonsense probably null
IGL01304:Lrif1 APN 3 106731733 missense probably damaging 1.00
IGL02209:Lrif1 APN 3 106731729 missense probably damaging 1.00
IGL02801:Lrif1 APN 3 106734614 missense possibly damaging 0.89
IGL02796:Lrif1 UTSW 3 106735436 missense probably benign 0.25
R0440:Lrif1 UTSW 3 106734398 missense possibly damaging 0.87
R0456:Lrif1 UTSW 3 106731778 missense probably benign 0.06
R0561:Lrif1 UTSW 3 106732165 missense probably damaging 1.00
R1160:Lrif1 UTSW 3 106732717 missense possibly damaging 0.95
R1720:Lrif1 UTSW 3 106733136 missense probably damaging 1.00
R1735:Lrif1 UTSW 3 106735846 makesense probably null
R1843:Lrif1 UTSW 3 106732811 missense probably damaging 0.99
R2016:Lrif1 UTSW 3 106732206 missense possibly damaging 0.94
R2200:Lrif1 UTSW 3 106734558 missense probably damaging 0.98
R3619:Lrif1 UTSW 3 106732546 missense probably damaging 1.00
R4750:Lrif1 UTSW 3 106735564 missense probably benign 0.33
R4878:Lrif1 UTSW 3 106735640 missense probably damaging 1.00
R4945:Lrif1 UTSW 3 106735753 missense probably damaging 1.00
R5286:Lrif1 UTSW 3 106732543 missense probably damaging 0.97
R5682:Lrif1 UTSW 3 106732568 missense possibly damaging 0.70
R6665:Lrif1 UTSW 3 106735343 intron probably null
R7011:Lrif1 UTSW 3 106732285 missense probably damaging 1.00
Z1088:Lrif1 UTSW 3 106732570 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCATGCTGAAGTGAAATC -3'
(R):5'- TCCTGCCAGAACTGTTGGTATTC -3'

Sequencing Primer
(F):5'- GCCCATGCTGAAGTGAAATCTGTAC -3'
(R):5'- TCCCAGATTTTTCCTACCTACAAAAG -3'
Posted On2017-10-10