Mutagenetix > Incidental Mutations

Incidental Mutation 'R6149:Rpe65'

489059

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

044296-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R6149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 159614143 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 217 (E217K)

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

Predicted Effect

probably benign
Transcript: ENSMUST00000029824
AA Change: E217K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: E217K

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196999
AA Change: E217K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: E217K

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930558K02Rik	T	A	1: 161,949,642	R115S	probably benign	Het
Adgre1	A	G	17: 57,445,018	K589E	probably benign	Het
Adgrv1	A	T	13: 81,182,774	L74Q	probably damaging	Het
Avil	A	G	10: 127,006,582	I77V	probably benign	Het
Best2	T	C	8: 85,013,267	E57G	probably benign	Het
C87977	A	G	4: 144,207,413	S375P	probably damaging	Het
Cacna1a	T	C	8: 84,569,952	C1200R	probably damaging	Het
Catsperb	T	A	12: 101,549,839	I578K	probably damaging	Het
Chsy1	A	G	7: 66,125,385	Y154C	probably damaging	Het
Chuk	A	G	19: 44,101,831	V74A	probably damaging	Het
Ckb	T	C	12: 111,671,814	S49G	probably damaging	Het
Crtac1	A	G	19: 42,283,609	Y632H	unknown	Het
Ern1	C	A	11: 106,405,815	E770*	probably null	Het
Fam114a2	A	C	11: 57,487,589	V450G	probably benign	Het
Fgf15	C	T	7: 144,899,769	Q125*	probably null	Het
Frem2	A	T	3: 53,551,341	S2036T	probably damaging	Het
Fxr2	G	A	11: 69,649,204	V296I	probably benign	Het
Gm15264	C	A	3: 94,733,429		noncoding transcript	Het
Gm340	T	A	19: 41,585,202	W799R	probably damaging	Het
Ifi213	A	T	1: 173,594,015	S103T	probably benign	Het
Igkv5-37	T	A	6: 69,963,488	Q57H	probably damaging	Het
Il1rap	A	G	16: 26,712,219	Y435C	probably damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Lnp1	C	T	16: 56,917,372	E118K	probably benign	Het
Lrif1	A	C	3: 106,732,327	K243Q	possibly damaging	Het
Lrp1b	G	T	2: 40,875,153		probably null	Het
Lvrn	G	A	18: 46,884,432	V610I	probably benign	Het
Med1	T	C	11: 98,183,853	K67R	possibly damaging	Het
Midn	T	C	10: 80,154,457	S278P	probably damaging	Het
Nrap	A	G	19: 56,389,453	V35A	possibly damaging	Het
Nynrin	A	T	14: 55,854,323	Q32L	possibly damaging	Het
Olfr1265	C	T	2: 90,037,516	A199V	probably benign	Het
Olfr1328	A	G	4: 118,934,431	L139P	probably damaging	Het
Olfr1444	A	T	19: 12,862,359	I195F	probably benign	Het
Olfr2	T	C	7: 107,001,600	I87V	probably benign	Het
Olfr218	G	T	1: 173,204,015	V220F	probably benign	Het
Oog1	C	T	12: 87,606,273	T113I	possibly damaging	Het
Otogl	C	T	10: 107,881,453	V386I	probably benign	Het
Patj	A	G	4: 98,424,325	N300S	possibly damaging	Het
Pcdhb16	T	A	18: 37,479,155	D389E	possibly damaging	Het
Pdcd6ip	T	C	9: 113,659,871	I699V	probably benign	Het
Pfas	A	G	11: 68,991,945	V790A	probably benign	Het
Plppr4	A	T	3: 117,322,394	C605S	probably benign	Het
Ppl	G	A	16: 5,107,596	Q60*	probably null	Het
Ppp1r1c	A	G	2: 79,756,466	K52R	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rufy4	T	C	1: 74,147,733	I560T	probably benign	Het
Ryr2	T	C	13: 11,669,017	S3054G	probably benign	Het
Serpinb6a	A	T	13: 33,918,360	L273H	probably damaging	Het
Sf3b1	A	T	1: 55,007,507	W293R	probably damaging	Het
Sik1	A	T	17: 31,848,797	S435T	possibly damaging	Het
Slc2a12	G	T	10: 22,664,502	M85I	probably benign	Het
Stk36	T	C	1: 74,634,229	S1094P	probably benign	Het
Tctn1	A	T	5: 122,246,586	Y393N	probably benign	Het
Tex9	C	T	9: 72,462,000		probably null	Het
Thbs2	A	G	17: 14,679,680		probably null	Het
Tmprss7	A	T	16: 45,673,905	C412*	probably null	Het
Tpp1	T	C	7: 105,747,727	T399A	probably benign	Het
Trim25	T	A	11: 89,015,536	V387D	probably benign	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vill	T	G	9: 119,058,414	V82G	possibly damaging	Het
Vmn1r189	T	C	13: 22,101,884	D261G	probably benign	Het
Vmn2r111	G	A	17: 22,548,815	T567I	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r60	A	G	7: 42,136,976	Y401C	probably damaging	Het
Zc3h11a	G	A	1: 133,638,875	R69*	probably null	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACTTGGTGGGACCCTTAG -3'
(R):5'- ACTCAGATTTACAGTGCTTACATGG -3'

Sequencing Primer
(F):5'- GAGCTATGAAAAATCCACATCTGAAG -3'
(R):5'- ACAGTGCTTACATGGAATTAATTGG -3'

Posted On

2017-10-10