Incidental Mutation 'R6149:Rpe65'
ID 489059
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms rd12, Mord1, A930029L06Rik
MMRRC Submission 044296-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.184) question?
Stock # R6149 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 159304812-159330958 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 159319780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 217 (E217K)
Ref Sequence ENSEMBL: ENSMUSP00000143654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]
AlphaFold Q91ZQ5
Predicted Effect probably benign
Transcript: ENSMUST00000029824
AA Change: E217K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: E217K

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196999
AA Change: E217K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: E217K

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,777,211 (GRCm39) R115S probably benign Het
Adgre1 A G 17: 57,752,018 (GRCm39) K589E probably benign Het
Adgrv1 A T 13: 81,330,893 (GRCm39) L74Q probably damaging Het
Avil A G 10: 126,842,451 (GRCm39) I77V probably benign Het
Best2 T C 8: 85,739,896 (GRCm39) E57G probably benign Het
Cacna1a T C 8: 85,296,581 (GRCm39) C1200R probably damaging Het
Catsperb T A 12: 101,516,098 (GRCm39) I578K probably damaging Het
Chsy1 A G 7: 65,775,133 (GRCm39) Y154C probably damaging Het
Chuk A G 19: 44,090,270 (GRCm39) V74A probably damaging Het
Ckb T C 12: 111,638,248 (GRCm39) S49G probably damaging Het
Crtac1 A G 19: 42,272,048 (GRCm39) Y632H unknown Het
Ern1 C A 11: 106,296,641 (GRCm39) E770* probably null Het
Fam114a2 A C 11: 57,378,415 (GRCm39) V450G probably benign Het
Fgf15 C T 7: 144,453,506 (GRCm39) Q125* probably null Het
Frem2 A T 3: 53,458,762 (GRCm39) S2036T probably damaging Het
Fxr2 G A 11: 69,540,030 (GRCm39) V296I probably benign Het
Gm15264 C A 3: 94,640,736 (GRCm39) noncoding transcript Het
Ifi213 A T 1: 173,421,581 (GRCm39) S103T probably benign Het
Igkv5-37 T A 6: 69,940,472 (GRCm39) Q57H probably damaging Het
Il1rap A G 16: 26,530,969 (GRCm39) Y435C probably damaging Het
Kl T A 5: 150,912,318 (GRCm39) M689K possibly damaging Het
Lcor T A 19: 41,573,641 (GRCm39) W799R probably damaging Het
Lnp1 C T 16: 56,737,735 (GRCm39) E118K probably benign Het
Lrif1 A C 3: 106,639,643 (GRCm39) K243Q possibly damaging Het
Lrp1b G T 2: 40,765,165 (GRCm39) probably null Het
Lvrn G A 18: 47,017,499 (GRCm39) V610I probably benign Het
Med1 T C 11: 98,074,679 (GRCm39) K67R possibly damaging Het
Midn T C 10: 79,990,291 (GRCm39) S278P probably damaging Het
Nrap A G 19: 56,377,885 (GRCm39) V35A possibly damaging Het
Nynrin A T 14: 56,091,780 (GRCm39) Q32L possibly damaging Het
Oog1 C T 12: 87,653,043 (GRCm39) T113I possibly damaging Het
Or10ak7 A G 4: 118,791,628 (GRCm39) L139P probably damaging Het
Or10j3 G T 1: 173,031,582 (GRCm39) V220F probably benign Het
Or4x11 C T 2: 89,867,860 (GRCm39) A199V probably benign Het
Or5b21 A T 19: 12,839,723 (GRCm39) I195F probably benign Het
Or6a2 T C 7: 106,600,807 (GRCm39) I87V probably benign Het
Otogl C T 10: 107,717,314 (GRCm39) V386I probably benign Het
Patj A G 4: 98,312,562 (GRCm39) N300S possibly damaging Het
Pcdhb16 T A 18: 37,612,208 (GRCm39) D389E possibly damaging Het
Pdcd6ip T C 9: 113,488,939 (GRCm39) I699V probably benign Het
Pfas A G 11: 68,882,771 (GRCm39) V790A probably benign Het
Plppr4 A T 3: 117,116,043 (GRCm39) C605S probably benign Het
Ppl G A 16: 4,925,460 (GRCm39) Q60* probably null Het
Ppp1r1c A G 2: 79,586,810 (GRCm39) K52R possibly damaging Het
Pramel29 A G 4: 143,933,983 (GRCm39) S375P probably damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Rufy4 T C 1: 74,186,892 (GRCm39) I560T probably benign Het
Ryr2 T C 13: 11,683,903 (GRCm39) S3054G probably benign Het
Serpinb6a A T 13: 34,102,343 (GRCm39) L273H probably damaging Het
Sf3b1 A T 1: 55,046,666 (GRCm39) W293R probably damaging Het
Sik1 A T 17: 32,067,771 (GRCm39) S435T possibly damaging Het
Slc2a12 G T 10: 22,540,401 (GRCm39) M85I probably benign Het
Stk36 T C 1: 74,673,388 (GRCm39) S1094P probably benign Het
Tctn1 A T 5: 122,384,649 (GRCm39) Y393N probably benign Het
Tex9 C T 9: 72,369,282 (GRCm39) probably null Het
Thbs2 A G 17: 14,899,942 (GRCm39) probably null Het
Tmprss7 A T 16: 45,494,268 (GRCm39) C412* probably null Het
Tpp1 T C 7: 105,396,934 (GRCm39) T399A probably benign Het
Trim25 T A 11: 88,906,362 (GRCm39) V387D probably benign Het
Usp45 A C 4: 21,810,797 (GRCm39) D331A probably damaging Het
Vill T G 9: 118,887,482 (GRCm39) V82G possibly damaging Het
Vmn1r189 T C 13: 22,286,054 (GRCm39) D261G probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r111 G A 17: 22,767,796 (GRCm39) T567I probably benign Het
Vmn2r60 A G 7: 41,786,400 (GRCm39) Y401C probably damaging Het
Zc3h11a G A 1: 133,566,613 (GRCm39) R69* probably null Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159,320,179 (GRCm39) missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159,306,042 (GRCm39) splice site probably benign
IGL01815:Rpe65 APN 3 159,310,167 (GRCm39) splice site probably null
IGL02085:Rpe65 APN 3 159,321,283 (GRCm39) missense probably benign 0.00
IGL02232:Rpe65 APN 3 159,309,988 (GRCm39) missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159,330,342 (GRCm39) missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159,312,128 (GRCm39) missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159,328,514 (GRCm39) missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159,305,998 (GRCm39) missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159,309,978 (GRCm39) missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159,320,154 (GRCm39) missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159,321,214 (GRCm39) missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159,330,360 (GRCm39) missense probably benign 0.35
R0571:Rpe65 UTSW 3 159,305,986 (GRCm39) missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159,307,220 (GRCm39) missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159,312,122 (GRCm39) missense probably benign 0.07
R1597:Rpe65 UTSW 3 159,320,421 (GRCm39) missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159,320,085 (GRCm39) missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159,328,485 (GRCm39) missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159,321,307 (GRCm39) missense probably benign
R2259:Rpe65 UTSW 3 159,321,208 (GRCm39) missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159,310,200 (GRCm39) missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159,310,037 (GRCm39) missense probably benign 0.16
R3975:Rpe65 UTSW 3 159,310,222 (GRCm39) missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159,310,047 (GRCm39) missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159,330,318 (GRCm39) missense probably benign
R4924:Rpe65 UTSW 3 159,328,268 (GRCm39) missense probably benign 0.01
R5269:Rpe65 UTSW 3 159,309,984 (GRCm39) missense probably benign 0.07
R5324:Rpe65 UTSW 3 159,310,041 (GRCm39) missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159,310,038 (GRCm39) missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159,321,313 (GRCm39) missense probably benign
R5907:Rpe65 UTSW 3 159,321,319 (GRCm39) critical splice donor site probably null
R6660:Rpe65 UTSW 3 159,320,345 (GRCm39) missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159,319,805 (GRCm39) missense probably benign 0.06
R7025:Rpe65 UTSW 3 159,328,322 (GRCm39) missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159,321,228 (GRCm39) missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159,328,491 (GRCm39) missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159,330,366 (GRCm39) missense probably benign 0.13
R7537:Rpe65 UTSW 3 159,310,246 (GRCm39) missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159,310,030 (GRCm39) missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159,320,342 (GRCm39) missense probably benign
R8179:Rpe65 UTSW 3 159,330,336 (GRCm39) missense probably benign 0.06
R8409:Rpe65 UTSW 3 159,319,785 (GRCm39) missense probably benign 0.01
R8558:Rpe65 UTSW 3 159,320,429 (GRCm39) missense probably damaging 1.00
R9042:Rpe65 UTSW 3 159,321,292 (GRCm39) missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159,328,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTTGGTGGGACCCTTAG -3'
(R):5'- ACTCAGATTTACAGTGCTTACATGG -3'

Sequencing Primer
(F):5'- GAGCTATGAAAAATCCACATCTGAAG -3'
(R):5'- ACAGTGCTTACATGGAATTAATTGG -3'
Posted On 2017-10-10