Incidental Mutation 'R6149:Fgf15'
ID489072
Institutional Source Beutler Lab
Gene Symbol Fgf15
Ensembl Gene ENSMUSG00000031073
Gene Namefibroblast growth factor 15
SynonymsFGF19
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location144896531-144900953 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 144899769 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 125 (Q125*)
Ref Sequence ENSEMBL: ENSMUSP00000146870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033389] [ENSMUST00000207229]
Predicted Effect probably null
Transcript: ENSMUST00000033389
AA Change: Q160*
SMART Domains Protein: ENSMUSP00000033389
Gene: ENSMUSG00000031073
AA Change: Q160*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FGF 49 177 1.93e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207040
Predicted Effect probably null
Transcript: ENSMUST00000207229
AA Change: Q125*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208515
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This growth factor is a high affinity, heparin dependent ligand for FGFR4. Expression of this gene was detected only in fetal but not adult brain tissue. Synergistic interaction of the chick homolog and Wnt-8c has been shown to be required for initiation of inner ear development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to a severe underrepresentation of homozygotes at weaning as well as highly penetrant ventricular septal defects and malalignment of the aorta and pulmonary trunk. No abnormalities in otic induction or otic vesicle formation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Fgf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Fgf15 APN 7 144899892 missense probably damaging 1.00
IGL00764:Fgf15 APN 7 144896935 splice site probably null
R1690:Fgf15 UTSW 7 144899928 missense probably damaging 1.00
R2444:Fgf15 UTSW 7 144899692 missense probably benign 0.03
R5073:Fgf15 UTSW 7 144896839 missense possibly damaging 0.94
R7287:Fgf15 UTSW 7 144896794 missense probably benign 0.27
R7396:Fgf15 UTSW 7 144899805 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGTTGATAGAAGAAGCACTCTGC -3'
(R):5'- GAATCCTGTCATTTCTGGAAGC -3'

Sequencing Primer
(F):5'- TCTGCTGGTTACCACTGGGAC -3'
(R):5'- AAGCTGGGACTCTTCACTAGG -3'
Posted On2017-10-10