Incidental Mutation 'R6149:Pdcd6ip'
ID489076
Institutional Source Beutler Lab
Gene Symbol Pdcd6ip
Ensembl Gene ENSMUSG00000032504
Gene Nameprogrammed cell death 6 interacting protein
SynonymsAlix, AIP1
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location113651744-113708259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113659871 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 699 (I699V)
Ref Sequence ENSEMBL: ENSMUSP00000107492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]
Predicted Effect probably benign
Transcript: ENSMUST00000035086
AA Change: I694V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504
AA Change: I694V

DomainStartEndE-ValueType
BRO1 3 382 1.99e-160 SMART
Pfam:ALIX_LYPXL_bnd 408 702 3.6e-91 PFAM
low complexity region 731 812 N/A INTRINSIC
Blast:BRO1 813 839 2e-11 BLAST
low complexity region 840 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111861
AA Change: I699V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504
AA Change: I699V

DomainStartEndE-ValueType
BRO1 3 387 3.46e-160 SMART
Pfam:ALIX_LYPXL_bnd 417 706 8.8e-96 PFAM
low complexity region 736 817 N/A INTRINSIC
Blast:BRO1 818 844 2e-11 BLAST
low complexity region 845 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142256
Meta Mutation Damage Score 0.1290 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Pdcd6ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pdcd6ip APN 9 113697518 missense possibly damaging 0.89
IGL00814:Pdcd6ip APN 9 113687653 missense probably damaging 0.97
IGL01092:Pdcd6ip APN 9 113680181 splice site probably benign
IGL01621:Pdcd6ip APN 9 113685422 missense probably benign 0.03
IGL01781:Pdcd6ip APN 9 113691498 missense probably damaging 1.00
IGL02158:Pdcd6ip APN 9 113680053 nonsense probably null
IGL03136:Pdcd6ip APN 9 113691499 missense probably damaging 1.00
IGL03137:Pdcd6ip APN 9 113657145 missense possibly damaging 0.69
IGL03246:Pdcd6ip APN 9 113678417 missense possibly damaging 0.93
R0230:Pdcd6ip UTSW 9 113685293 splice site probably benign
R0284:Pdcd6ip UTSW 9 113662504 missense probably damaging 1.00
R0862:Pdcd6ip UTSW 9 113674510 splice site probably benign
R0864:Pdcd6ip UTSW 9 113674510 splice site probably benign
R1025:Pdcd6ip UTSW 9 113662286 missense probably damaging 1.00
R1687:Pdcd6ip UTSW 9 113700019 missense probably damaging 1.00
R1699:Pdcd6ip UTSW 9 113678354 missense probably damaging 1.00
R1957:Pdcd6ip UTSW 9 113708022 missense probably damaging 1.00
R2317:Pdcd6ip UTSW 9 113672774 missense probably benign 0.03
R2698:Pdcd6ip UTSW 9 113674507 splice site probably null
R4182:Pdcd6ip UTSW 9 113700010 missense probably benign 0.00
R5154:Pdcd6ip UTSW 9 113691542 missense probably damaging 1.00
R5229:Pdcd6ip UTSW 9 113678333 missense probably damaging 0.99
R5391:Pdcd6ip UTSW 9 113691518 missense probably damaging 1.00
R5972:Pdcd6ip UTSW 9 113662298 missense probably benign 0.07
R6406:Pdcd6ip UTSW 9 113674344 missense possibly damaging 0.81
R6514:Pdcd6ip UTSW 9 113689694 missense probably benign 0.43
R6869:Pdcd6ip UTSW 9 113655106 missense unknown
R6888:Pdcd6ip UTSW 9 113671837 missense probably benign 0.04
R7078:Pdcd6ip UTSW 9 113659885 missense probably benign 0.01
R7683:Pdcd6ip UTSW 9 113687695 missense probably damaging 1.00
Z1177:Pdcd6ip UTSW 9 113685369 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCGCTCTTTCATGCCAGATCAAG -3'
(R):5'- GTGTCAGTGACCAATCTTAGGAC -3'

Sequencing Primer
(F):5'- ATCAAGGCGCCCTATGACTCTG -3'
(R):5'- GCTACTCGACAGATTGTATGAATGC -3'
Posted On2017-10-10