Mutagenetix > Incidental Mutation

Incidental Mutation 'R6149:Pfas'

489083

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

044296-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6149 (G1)

Quality Score

212.009

Status

Validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68991945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 790 (V790A)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

AlphaFold

Q5SUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000021282
AA Change: V790A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: V790A

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146490

Predicted Effect

probably benign
Transcript: ENSMUST00000149703

SMART Domains

Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	3	110	4e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152964

SMART Domains

Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	2	94	1.6e-12	PFAM
GATase_5	166	468	6.88e-120	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174986

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930558K02Rik	T	A	1: 161,949,642	R115S	probably benign	Het
Adgre1	A	G	17: 57,445,018	K589E	probably benign	Het
Adgrv1	A	T	13: 81,182,774	L74Q	probably damaging	Het
Avil	A	G	10: 127,006,582	I77V	probably benign	Het
Best2	T	C	8: 85,013,267	E57G	probably benign	Het
C87977	A	G	4: 144,207,413	S375P	probably damaging	Het
Cacna1a	T	C	8: 84,569,952	C1200R	probably damaging	Het
Catsperb	T	A	12: 101,549,839	I578K	probably damaging	Het
Chsy1	A	G	7: 66,125,385	Y154C	probably damaging	Het
Chuk	A	G	19: 44,101,831	V74A	probably damaging	Het
Ckb	T	C	12: 111,671,814	S49G	probably damaging	Het
Crtac1	A	G	19: 42,283,609	Y632H	unknown	Het
Ern1	C	A	11: 106,405,815	E770*	probably null	Het
Fam114a2	A	C	11: 57,487,589	V450G	probably benign	Het
Fgf15	C	T	7: 144,899,769	Q125*	probably null	Het
Frem2	A	T	3: 53,551,341	S2036T	probably damaging	Het
Fxr2	G	A	11: 69,649,204	V296I	probably benign	Het
Gm15264	C	A	3: 94,733,429		noncoding transcript	Het
Gm340	T	A	19: 41,585,202	W799R	probably damaging	Het
Ifi213	A	T	1: 173,594,015	S103T	probably benign	Het
Igkv5-37	T	A	6: 69,963,488	Q57H	probably damaging	Het
Il1rap	A	G	16: 26,712,219	Y435C	probably damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Lnp1	C	T	16: 56,917,372	E118K	probably benign	Het
Lrif1	A	C	3: 106,732,327	K243Q	possibly damaging	Het
Lrp1b	G	T	2: 40,875,153		probably null	Het
Lvrn	G	A	18: 46,884,432	V610I	probably benign	Het
Med1	T	C	11: 98,183,853	K67R	possibly damaging	Het
Midn	T	C	10: 80,154,457	S278P	probably damaging	Het
Nrap	A	G	19: 56,389,453	V35A	possibly damaging	Het
Nynrin	A	T	14: 55,854,323	Q32L	possibly damaging	Het
Olfr1265	C	T	2: 90,037,516	A199V	probably benign	Het
Olfr1328	A	G	4: 118,934,431	L139P	probably damaging	Het
Olfr1444	A	T	19: 12,862,359	I195F	probably benign	Het
Olfr2	T	C	7: 107,001,600	I87V	probably benign	Het
Olfr218	G	T	1: 173,204,015	V220F	probably benign	Het
Oog1	C	T	12: 87,606,273	T113I	possibly damaging	Het
Otogl	C	T	10: 107,881,453	V386I	probably benign	Het
Patj	A	G	4: 98,424,325	N300S	possibly damaging	Het
Pcdhb16	T	A	18: 37,479,155	D389E	possibly damaging	Het
Pdcd6ip	T	C	9: 113,659,871	I699V	probably benign	Het
Plppr4	A	T	3: 117,322,394	C605S	probably benign	Het
Ppl	G	A	16: 5,107,596	Q60*	probably null	Het
Ppp1r1c	A	G	2: 79,756,466	K52R	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rpe65	G	A	3: 159,614,143	E217K	probably benign	Het
Rufy4	T	C	1: 74,147,733	I560T	probably benign	Het
Ryr2	T	C	13: 11,669,017	S3054G	probably benign	Het
Serpinb6a	A	T	13: 33,918,360	L273H	probably damaging	Het
Sf3b1	A	T	1: 55,007,507	W293R	probably damaging	Het
Sik1	A	T	17: 31,848,797	S435T	possibly damaging	Het
Slc2a12	G	T	10: 22,664,502	M85I	probably benign	Het
Stk36	T	C	1: 74,634,229	S1094P	probably benign	Het
Tctn1	A	T	5: 122,246,586	Y393N	probably benign	Het
Tex9	C	T	9: 72,462,000		probably null	Het
Thbs2	A	G	17: 14,679,680		probably null	Het
Tmprss7	A	T	16: 45,673,905	C412*	probably null	Het
Tpp1	T	C	7: 105,747,727	T399A	probably benign	Het
Trim25	T	A	11: 89,015,536	V387D	probably benign	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vill	T	G	9: 119,058,414	V82G	possibly damaging	Het
Vmn1r189	T	C	13: 22,101,884	D261G	probably benign	Het
Vmn2r111	G	A	17: 22,548,815	T567I	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r60	A	G	7: 42,136,976	Y401C	probably damaging	Het
Zc3h11a	G	A	1: 133,638,875	R69*	probably null	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	splice site	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4599:Pfas	UTSW	11	68991069	missense	probably benign	0.15
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5328:Pfas	UTSW	11	68988592	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5427:Pfas	UTSW	11	69001153	missense	possibly damaging	0.90
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R5645:Pfas	UTSW	11	68991132	missense	probably damaging	1.00
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6915:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6945:Pfas	UTSW	11	69000530	missense	probably benign
R6957:Pfas	UTSW	11	68993883	missense	probably benign	0.14
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
R8103:Pfas	UTSW	11	68992293	missense	probably damaging	0.98
R8248:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R8804:Pfas	UTSW	11	68991082	missense
R8853:Pfas	UTSW	11	68992918	missense	probably damaging	1.00
R9032:Pfas	UTSW	11	68988595	missense
R9050:Pfas	UTSW	11	68991741	missense	probably benign	0.01
R9283:Pfas	UTSW	11	68993882	missense	probably damaging	1.00
R9644:Pfas	UTSW	11	68992716	missense	probably benign	0.23
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGACCCTACCGAGCAAAGAG -3'
(R):5'- CCAACCTGGTGTTTGCTCTG -3'

Sequencing Primer
(F):5'- GACCCTACCGAGCAAAGAGAAATAAG -3'
(R):5'- TGGGCCTCTGCATCCATCAG -3'

Posted On

2017-10-10