Incidental Mutation 'R6149:Fxr2'
ID489084
Institutional Source Beutler Lab
Gene Symbol Fxr2
Ensembl Gene ENSMUSG00000018765
Gene Namefragile X mental retardation, autosomal homolog 2
SynonymsFxr2h
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69632990-69653297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69649204 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 296 (V296I)
Ref Sequence ENSEMBL: ENSMUSP00000018909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018909]
Predicted Effect probably benign
Transcript: ENSMUST00000018909
AA Change: V296I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765
AA Change: V296I

DomainStartEndE-ValueType
Pfam:Agenet 72 130 1.3e-10 PFAM
KH 227 294 3.06e-3 SMART
KH 295 366 4.16e-5 SMART
low complexity region 368 380 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 475 503 N/A INTRINSIC
Pfam:FXR_C1 504 579 2.5e-36 PFAM
low complexity region 586 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139605
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperactivity, impaired Morris water task performance, and reductions in prepulse inhibition, contextual conditioned fear, and sensitivity to heat stimulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Fxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Fxr2 APN 11 69642139 missense possibly damaging 0.77
IGL00595:Fxr2 APN 11 69649192 missense probably benign 0.01
IGL00659:Fxr2 APN 11 69640250 missense probably benign 0.12
IGL00921:Fxr2 APN 11 69652240 missense probably damaging 1.00
IGL01025:Fxr2 APN 11 69643887 missense probably damaging 1.00
IGL01154:Fxr2 APN 11 69641433 splice site probably benign
IGL01347:Fxr2 APN 11 69652288 missense probably benign 0.27
IGL01743:Fxr2 APN 11 69652622 missense possibly damaging 0.53
IGL01981:Fxr2 APN 11 69650502 missense possibly damaging 0.95
IGL02332:Fxr2 APN 11 69649838 critical splice donor site probably null
IGL02385:Fxr2 APN 11 69652269 missense possibly damaging 0.82
IGL03172:Fxr2 APN 11 69649839 critical splice donor site probably null
R0092:Fxr2 UTSW 11 69642146 splice site probably benign
R0720:Fxr2 UTSW 11 69639415 missense probably benign 0.03
R1112:Fxr2 UTSW 11 69652248 missense probably damaging 1.00
R1344:Fxr2 UTSW 11 69648884 missense possibly damaging 0.68
R1635:Fxr2 UTSW 11 69641313 missense possibly damaging 0.77
R1864:Fxr2 UTSW 11 69652277 missense probably benign 0.30
R1957:Fxr2 UTSW 11 69643940 missense probably benign 0.03
R1992:Fxr2 UTSW 11 69649833 missense possibly damaging 0.92
R2243:Fxr2 UTSW 11 69642070 missense possibly damaging 0.93
R2863:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R2865:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R5255:Fxr2 UTSW 11 69643841 missense probably benign 0.03
R5726:Fxr2 UTSW 11 69633346 missense probably benign 0.00
R5899:Fxr2 UTSW 11 69652685 missense probably damaging 1.00
R6045:Fxr2 UTSW 11 69651051 missense possibly damaging 0.90
R6146:Fxr2 UTSW 11 69641339 missense possibly damaging 0.82
R6195:Fxr2 UTSW 11 69652273 missense probably benign 0.30
R6622:Fxr2 UTSW 11 69641590 critical splice donor site probably null
R7381:Fxr2 UTSW 11 69642049 missense possibly damaging 0.89
R7382:Fxr2 UTSW 11 69641556 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAGATTGGACTATTGGGGCC -3'
(R):5'- TCCTGCTTCTAGGAATCTCAAAC -3'

Sequencing Primer
(F):5'- GGCCTTTGGGTGACAGAG -3'
(R):5'- GGAATCTCAAACTTTCTATGGGAC -3'
Posted On2017-10-10