Incidental Mutation 'R6149:Nynrin'
ID489095
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55854323 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 32 (Q32L)
Ref Sequence ENSEMBL: ENSMUSP00000129557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479] [ENSMUST00000227465]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100529
AA Change: Q32L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: Q32L

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168479
AA Change: Q32L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: Q32L

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000227465
AA Change: Q32L

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6501:Nynrin UTSW 14 55863532 missense probably benign
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AGCAGGAAGGGTTTGTCTCC -3'
(R):5'- CTTGACTGTTCAGGAGAGAGGG -3'

Sequencing Primer
(F):5'- CGTGGCTTAGGCTGCAG -3'
(R):5'- TTCAGGAGAGAGGGAGAGGATCTG -3'
Posted On2017-10-10