Mutagenetix > Incidental Mutation

Incidental Mutation 'R6149:Vmn2r111'

489102

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

044296-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R6149 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 22548815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 567 (T567I)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491
AA Change: T567I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: T567I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.1%

Validation Efficiency

99% (69/70)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930558K02Rik	T	A	1: 161,949,642	R115S	probably benign	Het
Adgre1	A	G	17: 57,445,018	K589E	probably benign	Het
Adgrv1	A	T	13: 81,182,774	L74Q	probably damaging	Het
Avil	A	G	10: 127,006,582	I77V	probably benign	Het
Best2	T	C	8: 85,013,267	E57G	probably benign	Het
C87977	A	G	4: 144,207,413	S375P	probably damaging	Het
Cacna1a	T	C	8: 84,569,952	C1200R	probably damaging	Het
Catsperb	T	A	12: 101,549,839	I578K	probably damaging	Het
Chsy1	A	G	7: 66,125,385	Y154C	probably damaging	Het
Chuk	A	G	19: 44,101,831	V74A	probably damaging	Het
Ckb	T	C	12: 111,671,814	S49G	probably damaging	Het
Crtac1	A	G	19: 42,283,609	Y632H	unknown	Het
Ern1	C	A	11: 106,405,815	E770*	probably null	Het
Fam114a2	A	C	11: 57,487,589	V450G	probably benign	Het
Fgf15	C	T	7: 144,899,769	Q125*	probably null	Het
Frem2	A	T	3: 53,551,341	S2036T	probably damaging	Het
Fxr2	G	A	11: 69,649,204	V296I	probably benign	Het
Gm15264	C	A	3: 94,733,429		noncoding transcript	Het
Gm340	T	A	19: 41,585,202	W799R	probably damaging	Het
Ifi213	A	T	1: 173,594,015	S103T	probably benign	Het
Igkv5-37	T	A	6: 69,963,488	Q57H	probably damaging	Het
Il1rap	A	G	16: 26,712,219	Y435C	probably damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Lnp1	C	T	16: 56,917,372	E118K	probably benign	Het
Lrif1	A	C	3: 106,732,327	K243Q	possibly damaging	Het
Lrp1b	G	T	2: 40,875,153		probably null	Het
Lvrn	G	A	18: 46,884,432	V610I	probably benign	Het
Med1	T	C	11: 98,183,853	K67R	possibly damaging	Het
Midn	T	C	10: 80,154,457	S278P	probably damaging	Het
Nrap	A	G	19: 56,389,453	V35A	possibly damaging	Het
Nynrin	A	T	14: 55,854,323	Q32L	possibly damaging	Het
Olfr1265	C	T	2: 90,037,516	A199V	probably benign	Het
Olfr1328	A	G	4: 118,934,431	L139P	probably damaging	Het
Olfr1444	A	T	19: 12,862,359	I195F	probably benign	Het
Olfr2	T	C	7: 107,001,600	I87V	probably benign	Het
Olfr218	G	T	1: 173,204,015	V220F	probably benign	Het
Oog1	C	T	12: 87,606,273	T113I	possibly damaging	Het
Otogl	C	T	10: 107,881,453	V386I	probably benign	Het
Patj	A	G	4: 98,424,325	N300S	possibly damaging	Het
Pcdhb16	T	A	18: 37,479,155	D389E	possibly damaging	Het
Pdcd6ip	T	C	9: 113,659,871	I699V	probably benign	Het
Pfas	A	G	11: 68,991,945	V790A	probably benign	Het
Plppr4	A	T	3: 117,322,394	C605S	probably benign	Het
Ppl	G	A	16: 5,107,596	Q60*	probably null	Het
Ppp1r1c	A	G	2: 79,756,466	K52R	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rpe65	G	A	3: 159,614,143	E217K	probably benign	Het
Rufy4	T	C	1: 74,147,733	I560T	probably benign	Het
Ryr2	T	C	13: 11,669,017	S3054G	probably benign	Het
Serpinb6a	A	T	13: 33,918,360	L273H	probably damaging	Het
Sf3b1	A	T	1: 55,007,507	W293R	probably damaging	Het
Sik1	A	T	17: 31,848,797	S435T	possibly damaging	Het
Slc2a12	G	T	10: 22,664,502	M85I	probably benign	Het
Stk36	T	C	1: 74,634,229	S1094P	probably benign	Het
Tctn1	A	T	5: 122,246,586	Y393N	probably benign	Het
Tex9	C	T	9: 72,462,000		probably null	Het
Thbs2	A	G	17: 14,679,680		probably null	Het
Tmprss7	A	T	16: 45,673,905	C412*	probably null	Het
Tpp1	T	C	7: 105,747,727	T399A	probably benign	Het
Trim25	T	A	11: 89,015,536	V387D	probably benign	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vill	T	G	9: 119,058,414	V82G	possibly damaging	Het
Vmn1r189	T	C	13: 22,101,884	D261G	probably benign	Het
Vmn2r60	A	G	7: 42,136,976	Y401C	probably damaging	Het
Zc3h11a	G	A	1: 133,638,875	R69*	probably null	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTGAGAGTCCTGTTATTGGCCTT -3'
(R):5'- ACTTTGTTGCTTTCATTTACCTAATG -3'

Sequencing Primer
(F):5'- CCTGTTATTGGCCTTAACAATTGGAG -3'
(R):5'- CACTGCCCTAATGTAATTGGACAGG -3'

Posted On

2017-10-10