Incidental Mutation 'R6149:Adgre1'
ID489105
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 044296-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57445018 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 589 (K589E)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect probably benign
Transcript: ENSMUST00000004850
AA Change: K589E

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: K589E

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086763
AA Change: K589E

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: K589E

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Meta Mutation Damage Score 0.1125 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2219:Adgre1 UTSW 17 57401912 missense possibly damaging 0.92
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
R7154:Adgre1 UTSW 17 57444087 splice site probably null
R7347:Adgre1 UTSW 17 57420441 missense probably damaging 1.00
R7459:Adgre1 UTSW 17 57449933 missense probably damaging 1.00
R7709:Adgre1 UTSW 17 57402519 missense unknown
R8187:Adgre1 UTSW 17 57420349 missense probably benign 0.00
R8210:Adgre1 UTSW 17 57445061 missense possibly damaging 0.94
R8223:Adgre1 UTSW 17 57361692 missense probably damaging 0.99
Z1176:Adgre1 UTSW 17 57361729 missense possibly damaging 0.76
Z1177:Adgre1 UTSW 17 57419374 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGCTGAGCTATCTTCCTGG -3'
(R):5'- CTCAGGAAAACATGAATGAGCTACC -3'

Sequencing Primer
(F):5'- GCTATCTTCCTGGCTCTGAAAGAAG -3'
(R):5'- TGAGCTACCAATACTCACCGTAAG -3'
Posted On2017-10-10