Incidental Mutation 'R6149:Crtac1'
ID489110
Institutional Source Beutler Lab
Gene Symbol Crtac1
Ensembl Gene ENSMUSG00000042401
Gene Namecartilage acidic protein 1
SynonymsLotus, Crtac1B, 2810454P21Rik
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location42283037-42431783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42283609 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 632 (Y632H)
Ref Sequence ENSEMBL: ENSMUSP00000044858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048630]
Predicted Effect unknown
Transcript: ENSMUST00000048630
AA Change: Y632H
SMART Domains Protein: ENSMUSP00000044858
Gene: ENSMUSG00000042401
AA Change: Y632H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:VCBS 63 133 6.6e-12 PFAM
Pfam:VCBS 254 311 2e-12 PFAM
Pfam:VCBS 300 364 4.9e-13 PFAM
low complexity region 403 417 N/A INTRINSIC
Pfam:UnbV_ASPIC 459 528 8.9e-18 PFAM
Pfam:EGF_CA 560 606 2.1e-13 PFAM
low complexity region 630 646 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175493
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in lateral olfactory tract morphology and axon fasciculation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nrap A G 19: 56,389,453 V35A possibly damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Crtac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Crtac1 APN 19 42323794 missense probably damaging 1.00
IGL01296:Crtac1 APN 19 42284213 missense probably damaging 1.00
IGL01991:Crtac1 APN 19 42414121 missense possibly damaging 0.96
IGL02811:Crtac1 APN 19 42333911 missense probably damaging 1.00
R1957:Crtac1 UTSW 19 42287944 missense possibly damaging 0.79
R2046:Crtac1 UTSW 19 42334053 missense probably damaging 1.00
R2125:Crtac1 UTSW 19 42323732 missense probably damaging 1.00
R2280:Crtac1 UTSW 19 42283567 missense unknown
R2281:Crtac1 UTSW 19 42283567 missense unknown
R3508:Crtac1 UTSW 19 42304741 missense probably benign 0.09
R3923:Crtac1 UTSW 19 42333947 missense probably damaging 1.00
R4072:Crtac1 UTSW 19 42304707 missense probably damaging 1.00
R4798:Crtac1 UTSW 19 42323801 missense possibly damaging 0.93
R4951:Crtac1 UTSW 19 42414131 missense probably benign
R4965:Crtac1 UTSW 19 42318740 missense probably damaging 1.00
R5190:Crtac1 UTSW 19 42333908 missense possibly damaging 0.50
R5579:Crtac1 UTSW 19 42304806 missense probably damaging 1.00
R5595:Crtac1 UTSW 19 42413951 missense probably benign 0.08
R5739:Crtac1 UTSW 19 42302173 missense probably damaging 1.00
R5872:Crtac1 UTSW 19 42309190 splice site probably null
R5936:Crtac1 UTSW 19 42323837 missense probably damaging 1.00
R6193:Crtac1 UTSW 19 42323797 missense possibly damaging 0.47
R6858:Crtac1 UTSW 19 42318735 missense possibly damaging 0.93
R7246:Crtac1 UTSW 19 42287926 missense probably benign
X0018:Crtac1 UTSW 19 42309114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTTCAAAGATGGCCACCC -3'
(R):5'- TGCAAATAGCTCCTCCAAGTC -3'

Sequencing Primer
(F):5'- AAAGATGGCCACCCCTGCTG -3'
(R):5'- CCAAGTCACCTTTGGCAGATAATTTC -3'
Posted On2017-10-10