Incidental Mutation 'R6149:Nrap'
ID489112
Institutional Source Beutler Lab
Gene Symbol Nrap
Ensembl Gene ENSMUSG00000049134
Gene Namenebulin-related anchoring protein
Synonyms
MMRRC Submission 044296-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6149 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location56320035-56390037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56389453 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 35 (V35A)
Ref Sequence ENSEMBL: ENSMUSP00000073228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040711] [ENSMUST00000073536] [ENSMUST00000095947] [ENSMUST00000166203] [ENSMUST00000167239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040711
AA Change: V35A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048364
Gene: ENSMUSG00000049134
AA Change: V35A

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 1.76e-2 SMART
NEBU 1418 1448 2.09e0 SMART
NEBU 1453 1483 6.4e-5 SMART
NEBU 1489 1519 8.63e-1 SMART
NEBU 1527 1557 1.33e-2 SMART
NEBU 1562 1592 1.84e-5 SMART
NEBU 1593 1623 7.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073536
AA Change: V35A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073228
Gene: ENSMUSG00000049134
AA Change: V35A

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.73e-10 SMART
NEBU 556 586 8.12e-7 SMART
NEBU 590 620 1.73e-1 SMART
NEBU 625 655 2.33e-7 SMART
NEBU 656 686 1.49e-5 SMART
NEBU 690 721 5.12e-4 SMART
NEBU 724 754 8.12e-7 SMART
NEBU 759 789 2.64e-6 SMART
NEBU 795 825 3.48e-6 SMART
NEBU 833 863 2.35e-3 SMART
NEBU 868 898 6.11e-2 SMART
NEBU 899 929 1.69e-4 SMART
NEBU 934 964 3.88e-4 SMART
NEBU 967 997 4e-6 SMART
NEBU 1002 1032 4.22e-5 SMART
NEBU 1038 1068 2.64e-6 SMART
NEBU 1076 1106 3.68e-5 SMART
NEBU 1111 1141 4.16e-4 SMART
NEBU 1142 1172 1.1e-3 SMART
NEBU 1177 1207 1.68e1 SMART
NEBU 1210 1240 4.59e-6 SMART
NEBU 1245 1275 4.06e-7 SMART
NEBU 1281 1311 1.99e-1 SMART
NEBU 1319 1349 1.85e-1 SMART
NEBU 1354 1384 1.39e-5 SMART
NEBU 1385 1415 4.03e-2 SMART
NEBU 1420 1450 1.76e-2 SMART
NEBU 1453 1483 2.09e0 SMART
NEBU 1488 1518 6.4e-5 SMART
NEBU 1524 1554 8.63e-1 SMART
NEBU 1562 1592 1.33e-2 SMART
NEBU 1597 1627 1.84e-5 SMART
NEBU 1628 1658 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095947
SMART Domains Protein: ENSMUSP00000093640
Gene: ENSMUSG00000049134

DomainStartEndE-ValueType
NEBU 86 115 1.2e-6 SMART
NEBU 120 150 9.1e-8 SMART
NEBU 157 186 1.4e-6 SMART
NEBU 226 255 1.8e-8 SMART
NEBU 264 294 2.5e-5 SMART
NEBU 300 330 7.8e-6 SMART
NEBU 368 398 6e-11 SMART
NEBU 403 433 1.1e-12 SMART
NEBU 439 469 5.2e-9 SMART
NEBU 473 503 1.1e-3 SMART
NEBU 508 538 1.5e-9 SMART
NEBU 539 569 1e-7 SMART
NEBU 573 604 3.3e-6 SMART
NEBU 607 637 5.4e-9 SMART
NEBU 642 672 1.7e-8 SMART
NEBU 678 708 2.3e-8 SMART
NEBU 716 746 1.5e-5 SMART
NEBU 751 781 4.1e-4 SMART
NEBU 782 812 1.1e-6 SMART
NEBU 817 847 2.6e-6 SMART
NEBU 850 880 2.6e-8 SMART
NEBU 885 915 2.7e-7 SMART
NEBU 921 951 1.7e-8 SMART
NEBU 959 989 2.4e-7 SMART
NEBU 994 1024 2.7e-6 SMART
NEBU 1025 1055 7.2e-6 SMART
NEBU 1060 1090 1.1e-1 SMART
NEBU 1093 1123 3e-8 SMART
NEBU 1128 1158 2.6e-9 SMART
NEBU 1164 1194 1.3e-3 SMART
NEBU 1202 1232 1.2e-3 SMART
NEBU 1237 1267 8.8e-8 SMART
NEBU 1268 1298 2.7e-4 SMART
NEBU 1303 1333 1.2e-4 SMART
NEBU 1336 1366 1.4e-2 SMART
NEBU 1371 1401 4.3e-7 SMART
NEBU 1407 1437 5.6e-3 SMART
NEBU 1445 1475 8.8e-5 SMART
NEBU 1480 1510 1.2e-7 SMART
NEBU 1511 1541 4.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166203
AA Change: V35A

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132582
Gene: ENSMUSG00000049134
AA Change: V35A

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.06e-10 SMART
NEBU 554 584 1.73e-1 SMART
NEBU 589 619 2.33e-7 SMART
NEBU 620 650 1.49e-5 SMART
NEBU 654 685 5.12e-4 SMART
NEBU 688 718 8.12e-7 SMART
NEBU 723 753 2.64e-6 SMART
NEBU 759 789 3.48e-6 SMART
NEBU 797 827 2.35e-3 SMART
NEBU 832 862 6.11e-2 SMART
NEBU 863 893 1.69e-4 SMART
NEBU 898 928 3.88e-4 SMART
NEBU 931 961 4e-6 SMART
NEBU 966 996 4.22e-5 SMART
NEBU 1002 1032 2.64e-6 SMART
NEBU 1040 1070 3.68e-5 SMART
NEBU 1075 1105 4.16e-4 SMART
NEBU 1106 1136 1.1e-3 SMART
NEBU 1141 1171 1.68e1 SMART
NEBU 1174 1204 4.59e-6 SMART
NEBU 1209 1239 4.06e-7 SMART
NEBU 1245 1275 1.99e-1 SMART
NEBU 1283 1313 1.85e-1 SMART
NEBU 1318 1348 1.39e-5 SMART
NEBU 1349 1379 4.03e-2 SMART
NEBU 1384 1414 1.76e-2 SMART
NEBU 1417 1447 2.09e0 SMART
NEBU 1452 1482 6.4e-5 SMART
NEBU 1488 1518 8.63e-1 SMART
NEBU 1526 1556 1.33e-2 SMART
NEBU 1561 1591 1.84e-5 SMART
NEBU 1592 1622 7.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167239
AA Change: V35A

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128196
Gene: ENSMUSG00000049134
AA Change: V35A

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 3.06e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T A 1: 161,949,642 R115S probably benign Het
Adgre1 A G 17: 57,445,018 K589E probably benign Het
Adgrv1 A T 13: 81,182,774 L74Q probably damaging Het
Avil A G 10: 127,006,582 I77V probably benign Het
Best2 T C 8: 85,013,267 E57G probably benign Het
C87977 A G 4: 144,207,413 S375P probably damaging Het
Cacna1a T C 8: 84,569,952 C1200R probably damaging Het
Catsperb T A 12: 101,549,839 I578K probably damaging Het
Chsy1 A G 7: 66,125,385 Y154C probably damaging Het
Chuk A G 19: 44,101,831 V74A probably damaging Het
Ckb T C 12: 111,671,814 S49G probably damaging Het
Crtac1 A G 19: 42,283,609 Y632H unknown Het
Ern1 C A 11: 106,405,815 E770* probably null Het
Fam114a2 A C 11: 57,487,589 V450G probably benign Het
Fgf15 C T 7: 144,899,769 Q125* probably null Het
Frem2 A T 3: 53,551,341 S2036T probably damaging Het
Fxr2 G A 11: 69,649,204 V296I probably benign Het
Gm15264 C A 3: 94,733,429 noncoding transcript Het
Gm340 T A 19: 41,585,202 W799R probably damaging Het
Ifi213 A T 1: 173,594,015 S103T probably benign Het
Igkv5-37 T A 6: 69,963,488 Q57H probably damaging Het
Il1rap A G 16: 26,712,219 Y435C probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Lnp1 C T 16: 56,917,372 E118K probably benign Het
Lrif1 A C 3: 106,732,327 K243Q possibly damaging Het
Lrp1b G T 2: 40,875,153 probably null Het
Lvrn G A 18: 46,884,432 V610I probably benign Het
Med1 T C 11: 98,183,853 K67R possibly damaging Het
Midn T C 10: 80,154,457 S278P probably damaging Het
Nynrin A T 14: 55,854,323 Q32L possibly damaging Het
Olfr1265 C T 2: 90,037,516 A199V probably benign Het
Olfr1328 A G 4: 118,934,431 L139P probably damaging Het
Olfr1444 A T 19: 12,862,359 I195F probably benign Het
Olfr2 T C 7: 107,001,600 I87V probably benign Het
Olfr218 G T 1: 173,204,015 V220F probably benign Het
Oog1 C T 12: 87,606,273 T113I possibly damaging Het
Otogl C T 10: 107,881,453 V386I probably benign Het
Patj A G 4: 98,424,325 N300S possibly damaging Het
Pcdhb16 T A 18: 37,479,155 D389E possibly damaging Het
Pdcd6ip T C 9: 113,659,871 I699V probably benign Het
Pfas A G 11: 68,991,945 V790A probably benign Het
Plppr4 A T 3: 117,322,394 C605S probably benign Het
Ppl G A 16: 5,107,596 Q60* probably null Het
Ppp1r1c A G 2: 79,756,466 K52R possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Rpe65 G A 3: 159,614,143 E217K probably benign Het
Rufy4 T C 1: 74,147,733 I560T probably benign Het
Ryr2 T C 13: 11,669,017 S3054G probably benign Het
Serpinb6a A T 13: 33,918,360 L273H probably damaging Het
Sf3b1 A T 1: 55,007,507 W293R probably damaging Het
Sik1 A T 17: 31,848,797 S435T possibly damaging Het
Slc2a12 G T 10: 22,664,502 M85I probably benign Het
Stk36 T C 1: 74,634,229 S1094P probably benign Het
Tctn1 A T 5: 122,246,586 Y393N probably benign Het
Tex9 C T 9: 72,462,000 probably null Het
Thbs2 A G 17: 14,679,680 probably null Het
Tmprss7 A T 16: 45,673,905 C412* probably null Het
Tpp1 T C 7: 105,747,727 T399A probably benign Het
Trim25 T A 11: 89,015,536 V387D probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vill T G 9: 119,058,414 V82G possibly damaging Het
Vmn1r189 T C 13: 22,101,884 D261G probably benign Het
Vmn2r111 G A 17: 22,548,815 T567I probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r60 A G 7: 42,136,976 Y401C probably damaging Het
Zc3h11a G A 1: 133,638,875 R69* probably null Het
Other mutations in Nrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Nrap APN 19 56372909 missense probably damaging 1.00
IGL00570:Nrap APN 19 56338113 missense probably benign 0.10
IGL00946:Nrap APN 19 56340626 splice site probably null
IGL01070:Nrap APN 19 56329084 missense probably damaging 1.00
IGL01111:Nrap APN 19 56345558 missense probably damaging 1.00
IGL01138:Nrap APN 19 56355538 missense probably damaging 1.00
IGL01290:Nrap APN 19 56361748 missense probably damaging 1.00
IGL01352:Nrap APN 19 56379836 missense probably benign 0.00
IGL01372:Nrap APN 19 56329102 critical splice acceptor site probably null
IGL01395:Nrap APN 19 56361793 missense probably damaging 1.00
IGL01413:Nrap APN 19 56389391 missense probably damaging 0.99
IGL01734:Nrap APN 19 56350309 missense probably damaging 1.00
IGL01933:Nrap APN 19 56388818 missense probably damaging 1.00
IGL02156:Nrap APN 19 56321000 missense probably damaging 1.00
IGL02415:Nrap APN 19 56382309 missense probably damaging 1.00
IGL02447:Nrap APN 19 56345519 nonsense probably null
IGL02864:Nrap APN 19 56350374 missense probably damaging 1.00
IGL02993:Nrap APN 19 56345533 missense probably damaging 1.00
IGL03003:Nrap APN 19 56321952 missense probably damaging 1.00
IGL03006:Nrap APN 19 56347164 missense probably benign 0.02
IGL03084:Nrap APN 19 56365454 missense probably damaging 1.00
IGL03136:Nrap APN 19 56342255 missense possibly damaging 0.69
IGL03272:Nrap APN 19 56345568 intron probably benign
IGL03389:Nrap APN 19 56351716 missense probably benign 0.10
R0116:Nrap UTSW 19 56355546 missense probably damaging 1.00
R0374:Nrap UTSW 19 56351622 missense probably damaging 1.00
R0715:Nrap UTSW 19 56357325 missense probably damaging 0.98
R0828:Nrap UTSW 19 56345558 missense probably damaging 1.00
R0883:Nrap UTSW 19 56345474 missense probably damaging 1.00
R1416:Nrap UTSW 19 56327293 missense possibly damaging 0.60
R1459:Nrap UTSW 19 56384130 missense probably benign 0.00
R1616:Nrap UTSW 19 56389823 missense probably damaging 1.00
R1676:Nrap UTSW 19 56335255 missense probably damaging 1.00
R1687:Nrap UTSW 19 56355529 missense probably damaging 0.99
R1766:Nrap UTSW 19 56335042 missense probably damaging 0.99
R1792:Nrap UTSW 19 56379158 missense probably benign 0.00
R1817:Nrap UTSW 19 56384055 unclassified probably benign
R1972:Nrap UTSW 19 56357353 missense probably damaging 1.00
R1982:Nrap UTSW 19 56384105 missense probably damaging 0.99
R2258:Nrap UTSW 19 56321962 missense possibly damaging 0.80
R2448:Nrap UTSW 19 56322030 missense possibly damaging 0.90
R3034:Nrap UTSW 19 56364005 missense probably damaging 1.00
R3801:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3804:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3923:Nrap UTSW 19 56380256 missense probably damaging 0.99
R3964:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3965:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3966:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3980:Nrap UTSW 19 56381552 missense probably benign 0.01
R4182:Nrap UTSW 19 56350327 missense probably damaging 1.00
R4499:Nrap UTSW 19 56351481 missense probably damaging 0.97
R4573:Nrap UTSW 19 56342338 critical splice acceptor site probably null
R4603:Nrap UTSW 19 56335024 critical splice donor site probably null
R4689:Nrap UTSW 19 56386026 missense probably damaging 0.97
R4749:Nrap UTSW 19 56380237 missense probably damaging 0.96
R4845:Nrap UTSW 19 56351470 missense probably benign 0.16
R4937:Nrap UTSW 19 56347220 missense probably damaging 1.00
R4962:Nrap UTSW 19 56378143 missense probably damaging 1.00
R5156:Nrap UTSW 19 56371845 missense possibly damaging 0.94
R5181:Nrap UTSW 19 56345528 missense possibly damaging 0.85
R5202:Nrap UTSW 19 56335151 missense probably damaging 1.00
R5262:Nrap UTSW 19 56320223 missense possibly damaging 0.95
R5301:Nrap UTSW 19 56379109 missense probably damaging 1.00
R5380:Nrap UTSW 19 56381603 missense probably damaging 1.00
R5576:Nrap UTSW 19 56321982 missense probably damaging 0.99
R5631:Nrap UTSW 19 56354121 missense probably benign 0.19
R5754:Nrap UTSW 19 56389484 missense possibly damaging 0.55
R5799:Nrap UTSW 19 56342169 nonsense probably null
R5899:Nrap UTSW 19 56340574 missense possibly damaging 0.80
R5910:Nrap UTSW 19 56342311 missense probably benign 0.00
R5994:Nrap UTSW 19 56351599 nonsense probably null
R6124:Nrap UTSW 19 56386026 missense probably damaging 0.97
R6182:Nrap UTSW 19 56361698 missense probably benign
R6245:Nrap UTSW 19 56354221 missense probably damaging 1.00
R6245:Nrap UTSW 19 56379875 missense possibly damaging 0.80
R6270:Nrap UTSW 19 56320198 missense probably benign 0.00
R6274:Nrap UTSW 19 56361721 missense probably benign 0.21
R6340:Nrap UTSW 19 56347184 missense probably damaging 1.00
R6547:Nrap UTSW 19 56351566 missense probably benign 0.00
R6734:Nrap UTSW 19 56345509 missense probably damaging 0.99
R6770:Nrap UTSW 19 56382537 intron probably null
R6812:Nrap UTSW 19 56351676 missense probably damaging 1.00
R6843:Nrap UTSW 19 56380219 missense probably damaging 1.00
R7207:Nrap UTSW 19 56345521 missense probably damaging 1.00
R7214:Nrap UTSW 19 56378135 missense probably benign 0.09
R7313:Nrap UTSW 19 56342268 missense probably damaging 0.97
R7515:Nrap UTSW 19 56366427 missense possibly damaging 0.94
R7662:Nrap UTSW 19 56320283 missense probably benign 0.00
R7819:Nrap UTSW 19 56335288 missense probably benign
R7836:Nrap UTSW 19 56350297 missense probably benign 0.00
R7895:Nrap UTSW 19 56354152 missense probably benign 0.00
R7919:Nrap UTSW 19 56350297 missense probably benign 0.00
R7978:Nrap UTSW 19 56354152 missense probably benign 0.00
R8041:Nrap UTSW 19 56364336 nonsense probably null
R8046:Nrap UTSW 19 56320251 missense possibly damaging 0.46
R8066:Nrap UTSW 19 56354130 missense possibly damaging 0.94
X0028:Nrap UTSW 19 56335220 nonsense probably null
Z1176:Nrap UTSW 19 56345517 frame shift probably null
Z1177:Nrap UTSW 19 56338092 missense probably damaging 1.00
Z1177:Nrap UTSW 19 56344764 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATATGAGTGTGCACCTCGGGAG -3'
(R):5'- CTTCTGCGCTGTTTCAAGG -3'

Sequencing Primer
(F):5'- AGAGGTGCTACTCGGAGTC -3'
(R):5'- CTGAAAGTCTGTGAGCTC -3'
Posted On2017-10-10