Incidental Mutation 'R6173:Rc3h2'
ID489117
Institutional Source Beutler Lab
Gene Symbol Rc3h2
Ensembl Gene ENSMUSG00000075376
Gene Namering finger and CCCH-type zinc finger domains 2
SynonymsMnab, D930043C02Rik, Rnf164, 2900024N03Rik, 9430019J22Rik
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6173 (G1)
Quality Score217.468
Status Validated
Chromosome2
Chromosomal Location37370069-37422903 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCC to GCCC at 37414733 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100143] [ENSMUST00000112934] [ENSMUST00000112936] [ENSMUST00000125619]
Predicted Effect probably null
Transcript: ENSMUST00000100143
SMART Domains Protein: ENSMUSP00000097721
Gene: ENSMUSG00000075376

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112934
SMART Domains Protein: ENSMUSP00000108556
Gene: ENSMUSG00000075376

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112936
SMART Domains Protein: ENSMUSP00000108558
Gene: ENSMUSG00000075376

DomainStartEndE-ValueType
RING 14 53 2.87e-5 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 1.58e-3 SMART
low complexity region 609 633 N/A INTRINSIC
low complexity region 668 688 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124218
Predicted Effect probably null
Transcript: ENSMUST00000125619
SMART Domains Protein: ENSMUSP00000145082
Gene: ENSMUSG00000075376

DomainStartEndE-ValueType
RING 14 53 1.4e-7 SMART
low complexity region 198 209 N/A INTRINSIC
ZnF_C3H1 410 437 6.9e-6 SMART
low complexity region 455 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204690
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele are viable and healthy but show increased TNF production by macrophages in response to LPS. Homozygotes for a different knock-out allele show postnatal lethality, decreased body size and weight, and an immature lung phenotype with decreased alveolar expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Rc3h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Rc3h2 APN 2 37389747 missense possibly damaging 0.59
IGL00944:Rc3h2 APN 2 37398238 splice site probably benign
IGL01065:Rc3h2 APN 2 37377844 splice site probably benign
IGL01966:Rc3h2 APN 2 37382777 splice site probably benign
IGL02123:Rc3h2 APN 2 37398253 missense probably damaging 1.00
IGL02174:Rc3h2 APN 2 37411225 missense probably benign 0.11
IGL02448:Rc3h2 APN 2 37389805 missense probably benign 0.08
IGL02539:Rc3h2 APN 2 37389715 missense probably benign 0.09
IGL02698:Rc3h2 APN 2 37405300 missense probably damaging 0.99
IGL02731:Rc3h2 APN 2 37382811 missense probably benign 0.00
IGL02958:Rc3h2 APN 2 37414700 missense probably damaging 1.00
IGL02959:Rc3h2 APN 2 37405354 missense probably damaging 1.00
PIT4468001:Rc3h2 UTSW 2 37399639 missense probably damaging 1.00
R0309:Rc3h2 UTSW 2 37379008 splice site probably benign
R0488:Rc3h2 UTSW 2 37389588 missense probably damaging 0.99
R0506:Rc3h2 UTSW 2 37376659 critical splice donor site probably null
R0612:Rc3h2 UTSW 2 37411215 missense possibly damaging 0.77
R0628:Rc3h2 UTSW 2 37382052 splice site probably benign
R0647:Rc3h2 UTSW 2 37409530 missense probably damaging 1.00
R0680:Rc3h2 UTSW 2 37399835 missense probably damaging 0.97
R0738:Rc3h2 UTSW 2 37405374 missense probably damaging 1.00
R2005:Rc3h2 UTSW 2 37389753 nonsense probably null
R2105:Rc3h2 UTSW 2 37399624 missense possibly damaging 0.89
R2133:Rc3h2 UTSW 2 37378916 missense probably benign 0.12
R2373:Rc3h2 UTSW 2 37379001 missense possibly damaging 0.94
R2414:Rc3h2 UTSW 2 37399819 critical splice donor site probably null
R2850:Rc3h2 UTSW 2 37377415 missense probably benign
R2913:Rc3h2 UTSW 2 37378959 missense possibly damaging 0.89
R2932:Rc3h2 UTSW 2 37378359 missense probably benign 0.10
R4441:Rc3h2 UTSW 2 37414514 critical splice donor site probably null
R4932:Rc3h2 UTSW 2 37389832 missense possibly damaging 0.77
R5114:Rc3h2 UTSW 2 37398361 splice site probably null
R5169:Rc3h2 UTSW 2 37405312 missense probably damaging 1.00
R5360:Rc3h2 UTSW 2 37389855 missense possibly damaging 0.59
R5477:Rc3h2 UTSW 2 37399630 missense possibly damaging 0.94
R5553:Rc3h2 UTSW 2 37398311 nonsense probably null
R5776:Rc3h2 UTSW 2 37378313 missense possibly damaging 0.59
R5842:Rc3h2 UTSW 2 37378371 missense possibly damaging 0.77
R5935:Rc3h2 UTSW 2 37414733 frame shift probably null
R6060:Rc3h2 UTSW 2 37399600 missense possibly damaging 0.77
R6112:Rc3h2 UTSW 2 37378887 missense possibly damaging 0.59
R6172:Rc3h2 UTSW 2 37414733 frame shift probably null
R6177:Rc3h2 UTSW 2 37389646 missense probably benign 0.02
R6455:Rc3h2 UTSW 2 37409470 missense probably damaging 1.00
R6457:Rc3h2 UTSW 2 37411139 critical splice donor site probably null
R6467:Rc3h2 UTSW 2 37382016 missense probably damaging 0.97
R6647:Rc3h2 UTSW 2 37382944 nonsense probably null
R6694:Rc3h2 UTSW 2 37400543 missense probably damaging 1.00
R6695:Rc3h2 UTSW 2 37414661 missense possibly damaging 0.88
R7054:Rc3h2 UTSW 2 37375246 missense probably benign 0.07
R7159:Rc3h2 UTSW 2 37409647 missense probably benign 0.39
R7162:Rc3h2 UTSW 2 37409605 missense possibly damaging 0.59
R7640:Rc3h2 UTSW 2 37377849 critical splice donor site probably null
R7676:Rc3h2 UTSW 2 37405332 missense possibly damaging 0.95
R8209:Rc3h2 UTSW 2 37376989 missense possibly damaging 0.77
R8226:Rc3h2 UTSW 2 37376989 missense possibly damaging 0.77
R8324:Rc3h2 UTSW 2 37400726 missense possibly damaging 0.77
X0013:Rc3h2 UTSW 2 37389786 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CACATCAATGTCTGTGTTTATGGC -3'
(R):5'- GTCTCTGGGTAAATGTGCAAAATG -3'

Sequencing Primer
(F):5'- TTTATGGCAGTCTGGTCAAAAGGAC -3'
(R):5'- CTGGGTAAATGTGCAAAATGTAATTC -3'
Posted On2017-10-10