Incidental Mutation 'R6173:Gm14412'
ID489121
Institutional Source Beutler Lab
Gene Symbol Gm14412
Ensembl Gene ENSMUSG00000078868
Gene Namepredicted gene 14412
Synonyms
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R6173 (G1)
Quality Score92.0077
Status Validated
Chromosome2
Chromosomal Location177314520-177324307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 177314537 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 522 (P522S)
Ref Sequence ENSEMBL: ENSMUSP00000104587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108959]
Predicted Effect probably damaging
Transcript: ENSMUST00000108959
AA Change: P522S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104587
Gene: ENSMUSG00000078868
AA Change: P522S

DomainStartEndE-ValueType
KRAB 4 66 1.54e-15 SMART
ZnF_C2H2 103 125 1.12e-3 SMART
ZnF_C2H2 131 153 2.15e-5 SMART
ZnF_C2H2 159 181 5.59e-4 SMART
ZnF_C2H2 187 209 1.98e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 6.52e-5 SMART
ZnF_C2H2 271 293 1.12e-3 SMART
ZnF_C2H2 299 321 5.59e-4 SMART
ZnF_C2H2 327 349 4.87e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 9.08e-4 SMART
ZnF_C2H2 411 433 4.87e-4 SMART
ZnF_C2H2 439 461 6.88e-4 SMART
ZnF_C2H2 467 489 4.61e-5 SMART
ZnF_C2H2 495 517 8.02e-5 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Gm14412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm14412 APN 2 177315686 missense probably benign
R0124:Gm14412 UTSW 2 177315912 splice site probably benign
R0507:Gm14412 UTSW 2 177314532 missense possibly damaging 0.46
R1833:Gm14412 UTSW 2 177315790 missense probably benign 0.00
R1908:Gm14412 UTSW 2 177315476 missense probably damaging 1.00
R1908:Gm14412 UTSW 2 177315837 missense probably benign 0.03
R2026:Gm14412 UTSW 2 177317105 missense possibly damaging 0.92
R2209:Gm14412 UTSW 2 177317436 missense probably damaging 1.00
R2656:Gm14412 UTSW 2 177315200 missense unknown
R3946:Gm14412 UTSW 2 177314685 nonsense probably null
R4430:Gm14412 UTSW 2 177315832 missense probably benign 0.09
R4537:Gm14412 UTSW 2 177314559 missense probably benign 0.06
R4595:Gm14412 UTSW 2 177315212 missense unknown
R4928:Gm14412 UTSW 2 177314580 missense probably benign 0.01
R5100:Gm14412 UTSW 2 177315115 missense probably damaging 0.99
R5434:Gm14412 UTSW 2 177314612 missense probably damaging 1.00
R5668:Gm14412 UTSW 2 177315609 nonsense probably null
R6558:Gm14412 UTSW 2 177314554 missense probably damaging 0.99
R6784:Gm14412 UTSW 2 177317340 missense probably benign 0.10
R7094:Gm14412 UTSW 2 177317345 missense probably damaging 1.00
R7182:Gm14412 UTSW 2 177315615 missense probably benign 0.44
R7254:Gm14412 UTSW 2 177317396 missense probably damaging 0.97
R7793:Gm14412 UTSW 2 177315867 missense possibly damaging 0.78
R7799:Gm14412 UTSW 2 177315797 missense probably benign 0.01
R8238:Gm14412 UTSW 2 177315318 missense unknown
RF001:Gm14412 UTSW 2 177317101 missense probably benign 0.04
RF007:Gm14412 UTSW 2 177315701 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGGAGGTCAATGCTTGCTGC -3'
(R):5'- GCAGTCATCTCCGAATACATAAGC -3'

Sequencing Primer
(F):5'- GCTTGCTGCAAAGGCTTTATAAC -3'
(R):5'- ACATACAGGAGAGAAACCCTATG -3'
Posted On2017-10-10