Incidental Mutation 'R6173:Vmn2r6'
ID489124
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Namevomeronasal 2, receptor 6
SynonymsEG620718, EG667069
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6173 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location64537561-64565298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 64559755 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 108 (P108A)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
Predicted Effect probably damaging
Transcript: ENSMUST00000165012
AA Change: P19A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: P19A

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176481
AA Change: P108A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: P108A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R7982:Vmn2r6 UTSW 3 64559820 missense probably damaging 1.00
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
R8337:Vmn2r6 UTSW 3 64556105 nonsense probably null
R8736:Vmn2r6 UTSW 3 64559800 missense probably damaging 1.00
R8962:Vmn2r6 UTSW 3 64556155 missense probably damaging 1.00
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAAACAGCAGCTGACATAGTTG -3'
(R):5'- AATAACTTCCCACACTACCTGTCTG -3'

Sequencing Primer
(F):5'- AGCAGCTGACATAGTTGATCCTC -3'
(R):5'- ACACTACCTGTCTGTCTGCTGTG -3'
Posted On2017-10-10