Incidental Mutation 'R6173:Trp73'
ID489133
Institutional Source Beutler Lab
Gene Symbol Trp73
Ensembl Gene ENSMUSG00000029026
Gene Nametransformation related protein 73
SynonymsdeltaNp73, p73, TAp73
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R6173 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154056253-154140208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154104341 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 54 (D54E)
Ref Sequence ENSEMBL: ENSMUSP00000101269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105644] [ENSMUST00000139634]
Predicted Effect probably damaging
Transcript: ENSMUST00000105644
AA Change: D54E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026
AA Change: D54E

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139634
AA Change: D94E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114736
Gene: ENSMUSG00000029026
AA Change: D94E

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:P53 152 204 3.1e-25 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Trp73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Trp73 APN 4 154081486 missense possibly damaging 0.82
IGL02264:Trp73 APN 4 154064428 missense probably null 0.98
IGL02344:Trp73 APN 4 154062043 missense possibly damaging 0.92
IGL02663:Trp73 APN 4 154062506 splice site probably null
IGL02956:Trp73 APN 4 154064463 splice site probably benign
IGL03093:Trp73 APN 4 154104873 missense probably benign 0.00
slowpoke UTSW 4 154064632 splice site probably null
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0363:Trp73 UTSW 4 154063949 missense probably benign 0.17
R0409:Trp73 UTSW 4 154064384 missense possibly damaging 0.81
R1161:Trp73 UTSW 4 154081323 splice site probably null
R1531:Trp73 UTSW 4 154063895 missense probably benign 0.31
R2002:Trp73 UTSW 4 154081445 missense probably damaging 1.00
R2185:Trp73 UTSW 4 154104817 critical splice donor site probably null
R3965:Trp73 UTSW 4 154062036 missense probably benign 0.03
R3966:Trp73 UTSW 4 154062036 missense probably benign 0.03
R4247:Trp73 UTSW 4 154064632 splice site probably null
R4595:Trp73 UTSW 4 154064417 missense probably damaging 0.99
R5170:Trp73 UTSW 4 154104838 missense possibly damaging 0.95
R5260:Trp73 UTSW 4 154062602 missense possibly damaging 0.48
R5622:Trp73 UTSW 4 154060592 missense possibly damaging 0.68
R6252:Trp73 UTSW 4 154064397 missense probably damaging 1.00
R6950:Trp73 UTSW 4 154062053 missense probably benign 0.18
R7043:Trp73 UTSW 4 154067007 splice site probably null
R7050:Trp73 UTSW 4 154081442 missense probably damaging 1.00
R7052:Trp73 UTSW 4 154064683 missense probably damaging 0.98
R7620:Trp73 UTSW 4 154059257 nonsense probably null
R8086:Trp73 UTSW 4 154116595 missense unknown
Z1176:Trp73 UTSW 4 154067012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTACCTAGGAATCGACAGTACC -3'
(R):5'- AACTCCGGAAGTCCAAGGAC -3'

Sequencing Primer
(F):5'- TCGACAGTACCATGAGCTCATTG -3'
(R):5'- CAAGGACATATGGCTTATCTCCTGG -3'
Posted On2017-10-10