Incidental Mutation 'R6173:Arap2'
ID489134
Institutional Source Beutler Lab
Gene Symbol Arap2
Ensembl Gene ENSMUSG00000037999
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
SynonymsCentd1
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6173 (G1)
Quality Score172.009
Status Not validated
Chromosome5
Chromosomal Location62602445-62766159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62749622 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 18 (I18N)
Ref Sequence ENSEMBL: ENSMUSP00000124743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076623] [ENSMUST00000159470]
Predicted Effect probably damaging
Transcript: ENSMUST00000076623
AA Change: I18N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: I18N

DomainStartEndE-ValueType
SAM 3 70 3.69e-7 SMART
low complexity region 222 233 N/A INTRINSIC
PH 481 574 6.45e-17 SMART
PH 586 679 9.05e-12 SMART
ArfGap 684 805 9.2e-33 SMART
PH 891 1003 1.51e-8 SMART
PH 1013 1112 9.21e-4 SMART
RhoGAP 1124 1300 1.36e-50 SMART
Pfam:RA 1325 1416 2.1e-7 PFAM
PH 1429 1533 2.68e-14 SMART
coiled coil region 1561 1590 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159470
AA Change: I18N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124743
Gene: ENSMUSG00000037999
AA Change: I18N

DomainStartEndE-ValueType
SAM 3 70 3.69e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Arap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Arap2 APN 5 62635962 missense probably damaging 1.00
IGL00642:Arap2 APN 5 62733058 nonsense probably null
IGL00705:Arap2 APN 5 62678023 missense probably damaging 1.00
IGL00942:Arap2 APN 5 62698389 nonsense probably null
IGL01069:Arap2 APN 5 62649856 missense probably benign
IGL01601:Arap2 APN 5 62641342 missense probably damaging 1.00
IGL01986:Arap2 APN 5 62621922 missense probably damaging 1.00
IGL02032:Arap2 APN 5 62670997 missense probably damaging 0.99
IGL02262:Arap2 APN 5 62642841 missense probably damaging 1.00
IGL02331:Arap2 APN 5 62649682 splice site probably benign
IGL02527:Arap2 APN 5 62749307 missense probably benign
IGL02803:Arap2 APN 5 62749109 missense probably benign
IGL02864:Arap2 APN 5 62677965 missense probably damaging 1.00
IGL03078:Arap2 APN 5 62733065 splice site probably benign
IGL03154:Arap2 APN 5 62642925 missense probably damaging 1.00
IGL03213:Arap2 APN 5 62749095 missense probably benign 0.00
IGL03279:Arap2 APN 5 62621910 missense probably damaging 1.00
IGL03288:Arap2 APN 5 62604616 missense probably benign 0.00
PIT4354001:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R0012:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0166:Arap2 UTSW 5 62676018 missense probably damaging 1.00
R0472:Arap2 UTSW 5 62706659 missense probably damaging 1.00
R0506:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0551:Arap2 UTSW 5 62641323 splice site probably null
R0607:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0617:Arap2 UTSW 5 62649907 splice site probably benign
R0975:Arap2 UTSW 5 62730886 splice site probably benign
R0976:Arap2 UTSW 5 62649884 missense probably damaging 1.00
R1164:Arap2 UTSW 5 62683477 missense probably damaging 1.00
R1268:Arap2 UTSW 5 62730621 missense probably benign 0.00
R1480:Arap2 UTSW 5 62669129 nonsense probably null
R1502:Arap2 UTSW 5 62604404 missense probably benign 0.00
R1543:Arap2 UTSW 5 62606155 nonsense probably null
R1865:Arap2 UTSW 5 62698263 missense probably damaging 0.97
R1962:Arap2 UTSW 5 62676664 missense possibly damaging 0.82
R2040:Arap2 UTSW 5 62748916 missense probably damaging 0.99
R2118:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2131:Arap2 UTSW 5 62677958 missense probably damaging 1.00
R2201:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2215:Arap2 UTSW 5 62677176 missense probably damaging 1.00
R3027:Arap2 UTSW 5 62669897 missense probably damaging 1.00
R3053:Arap2 UTSW 5 62748857 missense probably benign 0.35
R3975:Arap2 UTSW 5 62748894 missense possibly damaging 0.87
R4272:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4273:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4326:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4327:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4328:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4451:Arap2 UTSW 5 62749170 missense probably benign 0.06
R4659:Arap2 UTSW 5 62654126 missense possibly damaging 0.94
R4665:Arap2 UTSW 5 62669969 missense possibly damaging 0.95
R4715:Arap2 UTSW 5 62749094 missense probably benign 0.43
R4808:Arap2 UTSW 5 62730641 missense probably benign 0.23
R4941:Arap2 UTSW 5 62749478 missense probably benign 0.20
R4983:Arap2 UTSW 5 62676525 missense probably damaging 0.98
R5095:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R5156:Arap2 UTSW 5 62669181 nonsense probably null
R5201:Arap2 UTSW 5 62683489 missense probably damaging 1.00
R5346:Arap2 UTSW 5 62714746 missense probably benign 0.39
R5359:Arap2 UTSW 5 62683419 nonsense probably null
R5426:Arap2 UTSW 5 62642816 missense probably benign 0.02
R5503:Arap2 UTSW 5 62630186 missense probably damaging 1.00
R5605:Arap2 UTSW 5 62615067 missense possibly damaging 0.47
R5764:Arap2 UTSW 5 62642854 missense probably damaging 1.00
R5813:Arap2 UTSW 5 62677163 missense probably damaging 1.00
R5846:Arap2 UTSW 5 62649773 missense probably damaging 1.00
R6084:Arap2 UTSW 5 62670954 missense possibly damaging 0.89
R6175:Arap2 UTSW 5 62714731 critical splice donor site probably null
R6249:Arap2 UTSW 5 62646193 missense probably damaging 0.99
R6386:Arap2 UTSW 5 62604522 missense possibly damaging 0.89
R6424:Arap2 UTSW 5 62683364 missense probably damaging 1.00
R6744:Arap2 UTSW 5 62748938 missense probably damaging 1.00
R6766:Arap2 UTSW 5 62677100 critical splice donor site probably null
R6990:Arap2 UTSW 5 62676517 missense probably damaging 0.96
R7067:Arap2 UTSW 5 62654044 critical splice donor site probably null
R7098:Arap2 UTSW 5 62675950 critical splice donor site probably null
R7107:Arap2 UTSW 5 62606208 missense probably damaging 0.98
R7156:Arap2 UTSW 5 62604571 missense probably damaging 1.00
R7174:Arap2 UTSW 5 62604278 missense probably benign
R7187:Arap2 UTSW 5 62669053 missense probably damaging 0.99
R7197:Arap2 UTSW 5 62641386 missense possibly damaging 0.89
R7214:Arap2 UTSW 5 62749338 missense probably benign 0.00
R7317:Arap2 UTSW 5 62649724 missense probably damaging 1.00
R7392:Arap2 UTSW 5 62698385 missense possibly damaging 0.54
R7438:Arap2 UTSW 5 62749475 missense probably damaging 0.99
R7452:Arap2 UTSW 5 62676549 missense probably benign 0.00
R7495:Arap2 UTSW 5 62676550 missense possibly damaging 0.78
R7796:Arap2 UTSW 5 62730762 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGAAGATGGATCACTGTG -3'
(R):5'- TCAGGTTTGAGCACATGAACAG -3'

Sequencing Primer
(F):5'- CACATTTGCATATATGGGGAAGTC -3'
(R):5'- GTTTGAGCACATGAACAGAAAATAAC -3'
Posted On2017-10-10