Incidental Mutation 'R6173:Baz1b'
ID489136
Institutional Source Beutler Lab
Gene Symbol Baz1b
Ensembl Gene ENSMUSG00000002748
Gene Namebromodomain adjacent to zinc finger domain, 1B
SynonymsWSTF, Wbscr9
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6173 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135187264-135246129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135242507 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1315 (S1315P)
Ref Sequence ENSEMBL: ENSMUSP00000002825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002825]
Predicted Effect probably benign
Transcript: ENSMUST00000002825
AA Change: S1315P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002825
Gene: ENSMUSG00000002748
AA Change: S1315P

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 21 120 2.6e-28 PFAM
low complexity region 312 335 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
coiled coil region 537 587 N/A INTRINSIC
DDT 605 669 5.59e-17 SMART
Pfam:WHIM1 725 773 2.2e-9 PFAM
low complexity region 822 835 N/A INTRINSIC
coiled coil region 854 890 N/A INTRINSIC
Pfam:WHIM2 900 935 1.3e-10 PFAM
Pfam:WHIM3 991 1029 1.5e-16 PFAM
low complexity region 1131 1148 N/A INTRINSIC
PHD 1186 1232 1.89e-14 SMART
RING 1187 1231 7.85e-2 SMART
low complexity region 1245 1277 N/A INTRINSIC
BROMO 1333 1441 3.63e-37 SMART
low complexity region 1459 1472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136947
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bromodomain protein family. The bromodomain is a structural motif characteristic of proteins involved in chromatin-dependent regulation of transcription. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality by P2, small size at birth, impaired double strand DNA repair, and heart defects. Mice heterozygous for a null allele exhibit hypercalcemia and heart defects. Mice homozygous for an ENU mutation exhibit craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Baz1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Baz1b APN 5 135216590 missense probably damaging 0.99
IGL00589:Baz1b APN 5 135196492 missense possibly damaging 0.50
IGL00736:Baz1b APN 5 135240032 missense probably damaging 1.00
IGL02053:Baz1b APN 5 135242466 missense probably benign 0.00
IGL02197:Baz1b APN 5 135209097 missense probably benign 0.20
IGL02236:Baz1b APN 5 135217284 missense probably damaging 1.00
IGL02351:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02358:Baz1b APN 5 135244306 missense probably damaging 1.00
IGL02424:Baz1b APN 5 135217979 missense probably damaging 1.00
IGL03051:Baz1b APN 5 135217225 missense probably benign 0.02
PIT4480001:Baz1b UTSW 5 135217965 missense probably damaging 1.00
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0097:Baz1b UTSW 5 135198259 missense probably benign 0.11
R0365:Baz1b UTSW 5 135240131 missense probably benign 0.00
R0655:Baz1b UTSW 5 135242430 missense probably benign 0.00
R0698:Baz1b UTSW 5 135198221 missense probably damaging 1.00
R0959:Baz1b UTSW 5 135244222 missense probably damaging 1.00
R1411:Baz1b UTSW 5 135230323 missense possibly damaging 0.73
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1469:Baz1b UTSW 5 135217979 missense probably damaging 1.00
R1511:Baz1b UTSW 5 135217782 missense probably damaging 1.00
R1557:Baz1b UTSW 5 135218243 missense possibly damaging 0.94
R1674:Baz1b UTSW 5 135205111 missense probably damaging 1.00
R1760:Baz1b UTSW 5 135242524 missense probably benign
R1951:Baz1b UTSW 5 135216739 missense probably benign 0.11
R2058:Baz1b UTSW 5 135217225 missense probably benign 0.02
R2060:Baz1b UTSW 5 135205114 missense probably damaging 1.00
R2142:Baz1b UTSW 5 135217275 missense probably damaging 1.00
R2496:Baz1b UTSW 5 135210775 missense probably damaging 1.00
R4088:Baz1b UTSW 5 135216940 missense probably damaging 0.96
R4397:Baz1b UTSW 5 135244446 missense probably damaging 1.00
R4784:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R4785:Baz1b UTSW 5 135217413 missense possibly damaging 0.51
R5386:Baz1b UTSW 5 135238059 missense probably damaging 1.00
R5653:Baz1b UTSW 5 135209097 missense probably benign 0.20
R5808:Baz1b UTSW 5 135221958 missense probably benign 0.00
R6010:Baz1b UTSW 5 135217451 missense possibly damaging 0.82
R6014:Baz1b UTSW 5 135217394 missense probably damaging 1.00
R6194:Baz1b UTSW 5 135243890 missense probably damaging 0.99
R6419:Baz1b UTSW 5 135242494 missense probably benign
R6435:Baz1b UTSW 5 135237945 missense probably damaging 1.00
R7078:Baz1b UTSW 5 135217439 missense probably benign 0.04
R7341:Baz1b UTSW 5 135223116 missense probably damaging 1.00
X0027:Baz1b UTSW 5 135216892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGCTAGAAGTGCTGGAAC -3'
(R):5'- AGAGCCTATCCATCTGCTGC -3'

Sequencing Primer
(F):5'- CTAGAAGTGCTGGAACCTGGC -3'
(R):5'- ACTAGAGGAGGCTAAGTAAC -3'
Posted On2017-10-10