Incidental Mutation 'R6173:Nlrp2'
ID 489140
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Pan1, Nbs1, E330007A02Rik, PYPAF2, Nalp2
MMRRC Submission 044316-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6173 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 5301546-5354034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5340808 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2 (E2G)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
AlphaFold Q4PLS0
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: E2G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: E2G

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 T C 3: 126,846,395 (GRCm39) D219G probably damaging Het
Arap2 A T 5: 62,906,965 (GRCm39) I18N probably damaging Het
Baz1b T C 5: 135,271,361 (GRCm39) S1315P probably benign Het
Bbs7 A T 3: 36,646,523 (GRCm39) C432* probably null Het
Bend3 A G 10: 43,385,864 (GRCm39) T86A probably benign Het
Cadm2 C T 16: 66,679,729 (GRCm39) V35I probably benign Het
Ch25h A G 19: 34,451,896 (GRCm39) S211P probably damaging Het
Chd5 A T 4: 152,463,848 (GRCm39) H1476L probably damaging Het
Chia1 T C 3: 106,036,338 (GRCm39) probably null Het
Clpx C A 9: 65,209,161 (GRCm39) S92* probably null Het
Dazl A T 17: 50,594,599 (GRCm39) M152K probably benign Het
Dnah17 A G 11: 117,930,772 (GRCm39) S3748P probably damaging Het
Dock2 T C 11: 34,212,388 (GRCm39) K1251R probably null Het
Esr1 T C 10: 4,696,760 (GRCm39) V203A probably damaging Het
F830045P16Rik A G 2: 129,305,588 (GRCm39) I262T probably damaging Het
Foxp1 G A 6: 98,992,471 (GRCm39) Q41* probably null Het
Foxp1 C A 6: 98,992,475 (GRCm39) probably null Het
Fshb T C 2: 106,887,638 (GRCm39) E127G possibly damaging Het
Galk2 A G 2: 125,701,137 (GRCm39) probably benign Het
Gid4 A G 11: 60,323,241 (GRCm39) D111G probably damaging Het
Gm14412 G A 2: 177,006,330 (GRCm39) P522S probably damaging Het
Iqank1 A G 15: 75,917,237 (GRCm39) E290G probably damaging Het
Mfap4 A G 11: 61,376,245 (GRCm39) probably null Het
Mfsd2a A G 4: 122,845,039 (GRCm39) V224A probably benign Het
Mocos A T 18: 24,809,639 (GRCm39) Y414F probably benign Het
Mrto4 T C 4: 139,077,755 (GRCm39) I27V probably benign Het
Muc4 A G 16: 32,554,958 (GRCm39) probably benign Het
Mug1 T A 6: 121,840,752 (GRCm39) I534N probably damaging Het
Mup20 A T 4: 61,972,267 (GRCm39) L7Q unknown Het
Or11g1 A G 14: 50,651,654 (GRCm39) I218V possibly damaging Het
Or12k7 A G 2: 36,959,091 (GRCm39) Y258C possibly damaging Het
Or2y16 T C 11: 49,335,299 (GRCm39) V207A probably benign Het
Or6z5 C T 7: 6,477,835 (GRCm39) A242V probably damaging Het
Parn T C 16: 13,469,675 (GRCm39) T209A possibly damaging Het
Psip1 T A 4: 83,391,286 (GRCm39) probably null Het
Ptprc A C 1: 137,995,628 (GRCm39) C1157G probably damaging Het
Rad17 A C 13: 100,759,389 (GRCm39) V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,304,745 (GRCm39) probably null Het
Safb A G 17: 56,904,798 (GRCm39) E124G probably damaging Het
Sart3 C T 5: 113,881,267 (GRCm39) A938T probably benign Het
Skint5 T C 4: 113,392,907 (GRCm39) T1242A unknown Het
Slc13a5 C T 11: 72,144,023 (GRCm39) E352K probably benign Het
Sohlh2 G T 3: 55,104,419 (GRCm39) V263F probably benign Het
Strn A G 17: 79,008,298 (GRCm39) Y107H probably damaging Het
Tbx15 G T 3: 99,161,203 (GRCm39) E3* probably null Het
Tespa1 A G 10: 130,183,172 (GRCm39) D39G probably benign Het
Trp73 A T 4: 154,188,798 (GRCm39) D54E probably damaging Het
Ttll5 A T 12: 85,980,151 (GRCm39) S912C probably damaging Het
Utp14b A T 1: 78,643,554 (GRCm39) D484V probably benign Het
Utp14b A C 1: 78,643,557 (GRCm39) N485T probably benign Het
Vmn2r29 T C 7: 7,234,369 (GRCm39) E839G probably benign Het
Vmn2r6 G C 3: 64,467,176 (GRCm39) P108A probably damaging Het
Vps8 T G 16: 21,314,682 (GRCm39) probably null Het
Zfp36l1 A T 12: 80,156,320 (GRCm39) probably null Het
Zfp998 T A 13: 66,579,608 (GRCm39) T292S probably benign Het
Zp3r A T 1: 130,519,305 (GRCm39) probably null Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5,340,547 (GRCm39) missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5,331,251 (GRCm39) missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5,322,238 (GRCm39) missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5,320,491 (GRCm39) missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5,340,769 (GRCm39) missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5,331,034 (GRCm39) missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5,330,822 (GRCm39) missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5,331,809 (GRCm39) missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5,338,566 (GRCm39) critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5,330,551 (GRCm39) nonsense probably null
IGL02803:Nlrp2 APN 7 5,331,317 (GRCm39) missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5,304,024 (GRCm39) missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5,320,482 (GRCm39) missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5,325,333 (GRCm39) unclassified probably benign
R0079:Nlrp2 UTSW 7 5,330,729 (GRCm39) missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5,325,417 (GRCm39) missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5,311,769 (GRCm39) missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5,331,328 (GRCm39) missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5,331,108 (GRCm39) missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5,331,544 (GRCm39) missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5,320,629 (GRCm39) missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5,322,221 (GRCm39) missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5,331,430 (GRCm39) missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5,330,490 (GRCm39) missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5,332,014 (GRCm39) splice site probably benign
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5,311,724 (GRCm39) missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5,330,715 (GRCm39) nonsense probably null
R1942:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5,328,005 (GRCm39) missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5,328,041 (GRCm39) missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5,322,237 (GRCm39) missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5,338,597 (GRCm39) missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5,331,128 (GRCm39) missense probably benign
R2334:Nlrp2 UTSW 7 5,340,534 (GRCm39) missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5,330,747 (GRCm39) missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5,322,286 (GRCm39) missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5,330,551 (GRCm39) nonsense probably null
R4021:Nlrp2 UTSW 7 5,328,011 (GRCm39) missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5,328,055 (GRCm39) missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5,322,188 (GRCm39) missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5,331,023 (GRCm39) missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5,331,950 (GRCm39) missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5,331,076 (GRCm39) missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5,330,614 (GRCm39) missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5,328,007 (GRCm39) missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5,331,118 (GRCm39) missense probably benign
R5390:Nlrp2 UTSW 7 5,303,908 (GRCm39) missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5,325,380 (GRCm39) missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5,327,902 (GRCm39) splice site probably null
R6274:Nlrp2 UTSW 7 5,320,554 (GRCm39) missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5,340,760 (GRCm39) missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5,303,925 (GRCm39) missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5,328,040 (GRCm39) nonsense probably null
R6814:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5,331,228 (GRCm39) nonsense probably null
R7028:Nlrp2 UTSW 7 5,331,571 (GRCm39) missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5,331,616 (GRCm39) missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5,320,533 (GRCm39) missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5,311,644 (GRCm39) missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5,330,627 (GRCm39) missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5,320,468 (GRCm39) critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5,322,167 (GRCm39) missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5,331,527 (GRCm39) missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5,330,650 (GRCm39) missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5,320,494 (GRCm39) missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5,330,548 (GRCm39) missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5,330,887 (GRCm39) missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5,327,978 (GRCm39) missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5,325,457 (GRCm39) missense probably null 0.00
R9038:Nlrp2 UTSW 7 5,330,478 (GRCm39) missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5,330,572 (GRCm39) missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5,304,052 (GRCm39) missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5,322,215 (GRCm39) missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5,330,641 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCTGTGAGAATTTCTGCTAGC -3'
(R):5'- GGAATTTGCTCCCTTTTGGC -3'

Sequencing Primer
(F):5'- GGTCCATTGTCAGCTTGT -3'
(R):5'- ATTTACATCCCAAATTTTATTCCCCG -3'
Posted On 2017-10-10