Incidental Mutation 'R6173:Olfr1346'
ID489141
Institutional Source Beutler Lab
Gene Symbol Olfr1346
Ensembl Gene ENSMUSG00000054938
Gene Nameolfactory receptor 1346
SynonymsMOR103-6, GA_x6K02T2QGBW-3203957-3204898
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6173 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location6467101-6478112 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6474836 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 242 (A242V)
Ref Sequence ENSEMBL: ENSMUSP00000150503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056144] [ENSMUST00000207658] [ENSMUST00000209866] [ENSMUST00000215302]
Predicted Effect probably damaging
Transcript: ENSMUST00000056144
AA Change: A242V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050553
Gene: ENSMUSG00000054938
AA Change: A242V

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 7.2e-44 PFAM
Pfam:7tm_1 45 295 5.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207658
AA Change: A242V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209866
Predicted Effect probably damaging
Transcript: ENSMUST00000215302
AA Change: A242V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4633 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Olfr1346
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0057:Olfr1346 UTSW 7 6474680 missense probably damaging 1.00
R0446:Olfr1346 UTSW 7 6475025 missense probably benign 0.00
R0531:Olfr1346 UTSW 7 6474235 missense possibly damaging 0.81
R0622:Olfr1346 UTSW 7 6474599 missense possibly damaging 0.46
R1596:Olfr1346 UTSW 7 6474515 missense probably damaging 1.00
R2233:Olfr1346 UTSW 7 6474442 missense possibly damaging 0.94
R2234:Olfr1346 UTSW 7 6474442 missense possibly damaging 0.94
R2235:Olfr1346 UTSW 7 6474442 missense possibly damaging 0.94
R4441:Olfr1346 UTSW 7 6474925 missense probably benign 0.01
R4888:Olfr1346 UTSW 7 6474613 missense probably damaging 0.97
R4890:Olfr1346 UTSW 7 6474849 nonsense probably null
R5696:Olfr1346 UTSW 7 6474743 splice site probably null
R6643:Olfr1346 UTSW 7 6474721 missense probably benign 0.11
R7404:Olfr1346 UTSW 7 6474164 missense probably damaging 1.00
R8120:Olfr1346 UTSW 7 6474120 missense probably benign 0.02
Z1177:Olfr1346 UTSW 7 6474390 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCAAGTCTGTCCTACTGTGG -3'
(R):5'- GACCTCCCTATTCCTCAAGCAG -3'

Sequencing Primer
(F):5'- GTCCTACTGTGGCCCCAATG -3'
(R):5'- CCCTATTCCTCAAGCAGTAGATG -3'
Posted On2017-10-10