Incidental Mutation 'R6173:Clpx'
ID489143
Institutional Source Beutler Lab
Gene Symbol Clpx
Ensembl Gene ENSMUSG00000015357
Gene Namecaseinolytic mitochondrial matrix peptidase chaperone subunit
Synonyms
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6173 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location65294260-65330658 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 65301879 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 92 (S92*)
Ref Sequence ENSEMBL: ENSMUSP00000109455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015501] [ENSMUST00000113824]
Predicted Effect probably null
Transcript: ENSMUST00000015501
AA Change: S92*
SMART Domains Protein: ENSMUSP00000015501
Gene: ENSMUSG00000015357
AA Change: S92*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
PDB:4I9K|B 173 209 6e-7 PDB
low complexity region 259 268 N/A INTRINSIC
AAA 286 437 1.64e-12 SMART
low complexity region 452 458 N/A INTRINSIC
ClpB_D2-small 510 604 1.16e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113824
AA Change: S92*
SMART Domains Protein: ENSMUSP00000109455
Gene: ENSMUSG00000015357
AA Change: S92*

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 81 101 N/A INTRINSIC
low complexity region 165 172 N/A INTRINSIC
low complexity region 245 254 N/A INTRINSIC
AAA 272 423 1.64e-12 SMART
low complexity region 438 444 N/A INTRINSIC
ClpB_D2-small 496 590 1.16e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155424
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protease found in mitochondria. This protease is ATP-dependent and targets specific proteins for degradation. The protease consists of two heptameric rings of the CLPP catalytic subunit sandwiched between two hexameric rings of the chaperone subunit encoded by this gene. Targeted proteins are unwound by this protein and then passed on to the CLPP subunit for degradation. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Clpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Clpx APN 9 65324270 missense probably damaging 1.00
IGL01394:Clpx APN 9 65310213 missense probably damaging 1.00
IGL01395:Clpx APN 9 65301851 missense probably benign 0.00
IGL01521:Clpx APN 9 65318744 missense probably damaging 1.00
IGL02141:Clpx APN 9 65312118 splice site probably null
IGL02512:Clpx APN 9 65310251 missense probably benign
IGL03008:Clpx APN 9 65322775 missense possibly damaging 0.76
IGL03146:Clpx APN 9 65326830 missense probably benign 0.01
IGL03152:Clpx APN 9 65310176 missense possibly damaging 0.56
IGL03309:Clpx APN 9 65322692 missense probably damaging 1.00
kneehigh UTSW 9 65301879 nonsense probably null
locust UTSW 9 65324301 critical splice donor site probably null
IGL02837:Clpx UTSW 9 65324259 missense probably damaging 1.00
R0167:Clpx UTSW 9 65316737 missense possibly damaging 0.53
R0399:Clpx UTSW 9 65322769 missense probably benign 0.03
R0666:Clpx UTSW 9 65310225 missense probably damaging 1.00
R1386:Clpx UTSW 9 65326888 missense probably null 0.88
R1594:Clpx UTSW 9 65324270 missense probably damaging 0.99
R2038:Clpx UTSW 9 65317493 missense probably damaging 1.00
R4131:Clpx UTSW 9 65316655 missense possibly damaging 0.64
R4715:Clpx UTSW 9 65312114 missense possibly damaging 0.92
R5107:Clpx UTSW 9 65308539 missense possibly damaging 0.93
R5248:Clpx UTSW 9 65320850 missense probably damaging 1.00
R5520:Clpx UTSW 9 65317448 nonsense probably null
R5639:Clpx UTSW 9 65329830 missense probably benign 0.00
R5718:Clpx UTSW 9 65299964 missense probably benign
R6109:Clpx UTSW 9 65299952 missense probably benign 0.02
R6172:Clpx UTSW 9 65301879 nonsense probably null
R6748:Clpx UTSW 9 65310159 missense probably benign 0.00
R7287:Clpx UTSW 9 65300013 nonsense probably null
R7409:Clpx UTSW 9 65324247 missense possibly damaging 0.94
R7806:Clpx UTSW 9 65299931 missense probably benign
R7814:Clpx UTSW 9 65324301 critical splice donor site probably null
R8212:Clpx UTSW 9 65320891 missense possibly damaging 0.46
X0067:Clpx UTSW 9 65316695 missense possibly damaging 0.86
Z1177:Clpx UTSW 9 65299997 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGGCTATAGATACAAACCATAC -3'
(R):5'- GAGAATCACAATGTCCGGGC -3'

Sequencing Primer
(F):5'- TTATGCCACTGAGGACACTG -3'
(R):5'- TGTCCGGGCAAAAATAATTCTGG -3'
Posted On2017-10-10