Incidental Mutation 'R6173:Slc13a5'
ID489150
Institutional Source Beutler Lab
Gene Symbol Slc13a5
Ensembl Gene ENSMUSG00000020805
Gene Namesolute carrier family 13 (sodium-dependent citrate transporter), member 5
SynonymsIndy, Nact, mINDY, NaC2/NaCT
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6173 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72241989-72267222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72253197 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 352 (E352K)
Ref Sequence ENSEMBL: ENSMUSP00000021161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021161] [ENSMUST00000137701] [ENSMUST00000208056] [ENSMUST00000208912]
Predicted Effect probably benign
Transcript: ENSMUST00000021161
AA Change: E352K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021161
Gene: ENSMUSG00000020805
AA Change: E352K

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 8 558 1.3e-121 PFAM
Pfam:CitMHS 13 172 1.6e-14 PFAM
Pfam:CitMHS 202 498 6.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137701
AA Change: E352K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000119417
Gene: ENSMUSG00000020805
AA Change: E352K

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 7 115 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208056
AA Change: E335K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000208912
AA Change: E309K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dazl A T 17: 50,287,571 M152K probably benign Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Slc13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Slc13a5 APN 11 72258954 splice site probably null
IGL03392:Slc13a5 APN 11 72245178 missense probably damaging 1.00
Punk UTSW 11 72262076 missense probably damaging 1.00
punk2 UTSW 11 72253391 missense possibly damaging 0.65
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0042:Slc13a5 UTSW 11 72259114 missense probably benign 0.31
R0194:Slc13a5 UTSW 11 72245233 missense probably benign 0.22
R0194:Slc13a5 UTSW 11 72262130 missense possibly damaging 0.95
R0234:Slc13a5 UTSW 11 72250800 missense probably damaging 0.98
R1499:Slc13a5 UTSW 11 72250731 missense probably damaging 0.97
R1655:Slc13a5 UTSW 11 72257378 missense probably benign 0.00
R1728:Slc13a5 UTSW 11 72266459 splice site probably null
R1818:Slc13a5 UTSW 11 72253343 missense probably benign 0.02
R2304:Slc13a5 UTSW 11 72259039 missense probably damaging 1.00
R2352:Slc13a5 UTSW 11 72252321 missense probably benign 0.06
R2408:Slc13a5 UTSW 11 72262076 missense probably damaging 1.00
R2919:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R2920:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R3103:Slc13a5 UTSW 11 72257388 missense probably damaging 1.00
R4772:Slc13a5 UTSW 11 72250846 critical splice acceptor site probably null
R4906:Slc13a5 UTSW 11 72257418 missense probably damaging 0.99
R5385:Slc13a5 UTSW 11 72259077 missense probably benign 0.01
R5562:Slc13a5 UTSW 11 72262039 missense probably damaging 0.99
R5878:Slc13a5 UTSW 11 72253391 missense possibly damaging 0.65
R6665:Slc13a5 UTSW 11 72260360 missense probably damaging 0.99
R7317:Slc13a5 UTSW 11 72245127 missense probably damaging 1.00
R7338:Slc13a5 UTSW 11 72266484 missense probably benign
R7908:Slc13a5 UTSW 11 72259064 missense probably benign 0.00
R8038:Slc13a5 UTSW 11 72253370 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GAAACAAATGCACCCGTAGTTTC -3'
(R):5'- AAACTTGCATCTGCTGTGGG -3'

Sequencing Primer
(F):5'- ATGCACCCGTAGTTTCATTCTGAAG -3'
(R):5'- CATCTGCTGTGGGGAGAAG -3'
Posted On2017-10-10