Incidental Mutation 'R6173:Dazl'
ID489158
Institutional Source Beutler Lab
Gene Symbol Dazl
Ensembl Gene ENSMUSG00000010592
Gene Namedeleted in azoospermia-like
SynonymsDaz-like, Tpx2, Dazla, Tpx-2
MMRRC Submission 044316-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6173 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location50279394-50293599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50287571 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 152 (M152K)
Ref Sequence ENSEMBL: ENSMUSP00000010736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010736]
PDB Structure
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH RNA, UUGUUCUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH MVH RNA, UGUUC [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE IN COMPLEX WITH SYCP3 RNA, UUGUUU [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE RRM DOMAIN OF MOUSE DELETED IN AZOOSPERMIA-LIKE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000010736
AA Change: M152K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000010736
Gene: ENSMUSG00000010592
AA Change: M152K

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
RRM 41 111 2.16e-19 SMART
low complexity region 125 146 N/A INTRINSIC
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a member of the depleted in azoospermia-like (DAZL) protein family. Members of this family contain an RNA recognition motif, interact with poly A binding proteins, and may be involved in the initiation of translation. The encoded protein is expressed in the cytoplasm of pluripotent stem cells, and in both male and female germ cells, where it is essential for gametogenesis. Disruption of this gene is associated with infertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Males homozygous for a targeted null mutation exhibit sterility with a complete absence of mature germ cells. In mutants, few spermatogonia enter meiosis, and those that do fail to proceed beyond pachytene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik T A 13: 66,431,549 T292S probably benign Het
Ank2 T C 3: 127,052,746 D219G probably damaging Het
Arap2 A T 5: 62,749,622 I18N probably damaging Het
Baz1b T C 5: 135,242,507 S1315P probably benign Het
Bbs7 A T 3: 36,592,374 C432* probably null Het
Bend3 A G 10: 43,509,868 T86A probably benign Het
Cadm2 C T 16: 66,882,841 V35I probably benign Het
Ch25h A G 19: 34,474,496 S211P probably damaging Het
Chd5 A T 4: 152,379,391 H1476L probably damaging Het
Chia1 T C 3: 106,129,022 probably null Het
Clpx C A 9: 65,301,879 S92* probably null Het
Dnah17 A G 11: 118,039,946 S3748P probably damaging Het
Dock2 T C 11: 34,262,388 K1251R probably null Het
Esr1 T C 10: 4,746,760 V203A probably damaging Het
F830045P16Rik A G 2: 129,463,668 I262T probably damaging Het
Foxp1 G A 6: 99,015,510 Q41* probably null Het
Foxp1 C A 6: 99,015,514 probably null Het
Fshb T C 2: 107,057,293 E127G possibly damaging Het
Galk2 A G 2: 125,859,217 probably benign Het
Gid4 A G 11: 60,432,415 D111G probably damaging Het
Gm14412 G A 2: 177,314,537 P522S probably damaging Het
K230010J24Rik A G 15: 76,045,388 E290G probably damaging Het
Mfap4 A G 11: 61,485,419 probably null Het
Mfsd2a A G 4: 122,951,246 V224A probably benign Het
Mocos A T 18: 24,676,582 Y414F probably benign Het
Mrto4 T C 4: 139,350,444 I27V probably benign Het
Muc4 A G 16: 32,736,140 probably benign Het
Mug1 T A 6: 121,863,793 I534N probably damaging Het
Mup20 A T 4: 62,054,030 L7Q unknown Het
Nlrp2 T C 7: 5,337,809 E2G probably damaging Het
Olfr1346 C T 7: 6,474,836 A242V probably damaging Het
Olfr1388 T C 11: 49,444,472 V207A probably benign Het
Olfr360 A G 2: 37,069,079 Y258C possibly damaging Het
Olfr738 A G 14: 50,414,197 I218V possibly damaging Het
Parn T C 16: 13,651,811 T209A possibly damaging Het
Psip1 T A 4: 83,473,049 probably null Het
Ptprc A C 1: 138,067,890 C1157G probably damaging Het
Rad17 A C 13: 100,622,881 V546G probably benign Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Safb A G 17: 56,597,798 E124G probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Skint5 T C 4: 113,535,710 T1242A unknown Het
Slc13a5 C T 11: 72,253,197 E352K probably benign Het
Sohlh2 G T 3: 55,196,998 V263F probably benign Het
Strn A G 17: 78,700,869 Y107H probably damaging Het
Tbx15 G T 3: 99,253,887 E3* probably null Het
Tespa1 A G 10: 130,347,303 D39G probably benign Het
Trp73 A T 4: 154,104,341 D54E probably damaging Het
Ttll5 A T 12: 85,933,377 S912C probably damaging Het
Utp14b A T 1: 78,665,837 D484V probably benign Het
Utp14b A C 1: 78,665,840 N485T probably benign Het
Vmn2r29 T C 7: 7,231,370 E839G probably benign Het
Vmn2r6 G C 3: 64,559,755 P108A probably damaging Het
Vps8 T G 16: 21,495,932 probably null Het
Zfp36l1 A T 12: 80,109,546 probably null Het
Zp3r A T 1: 130,591,568 probably null Het
Other mutations in Dazl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Dazl APN 17 50293398 splice site probably benign
R0063:Dazl UTSW 17 152705859 missense probably damaging 1.00
R3801:Dazl UTSW 17 50281281 missense probably benign 0.44
R3961:Dazl UTSW 17 50288133 missense probably damaging 0.99
R4646:Dazl UTSW 17 50288155 missense probably damaging 1.00
R5310:Dazl UTSW 17 50281283 missense probably damaging 1.00
R5389:Dazl UTSW 17 50288690 missense probably benign 0.25
R5933:Dazl UTSW 17 50287753 critical splice donor site probably null
R7057:Dazl UTSW 17 50293406 start codon destroyed probably null
R7523:Dazl UTSW 17 50287541 missense probably damaging 0.97
R8393:Dazl UTSW 17 50281266 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGCATAAACAGCGCTAAGAATGAC -3'
(R):5'- TGAAACTGGGCCCTGCAATC -3'

Sequencing Primer
(F):5'- CAGCGCTAAGAATGACAGTAATAAC -3'
(R):5'- TGCAATCAGGAAACAAAATTTATGTG -3'
Posted On2017-10-10