Incidental Mutation 'R6150:Pla2g4d'
ID 489168
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Name phospholipase A2, group IVD
Synonyms Pla2delta, 2610311B01Rik
MMRRC Submission 044297-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6150 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120096347-120119678 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120100045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 674 (D674G)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
AlphaFold Q50L43
Predicted Effect probably damaging
Transcript: ENSMUST00000094665
AA Change: D674G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: D674G

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Meta Mutation Damage Score 0.9305 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,104,334 (GRCm39) T74A probably benign Het
Arhgef1 T C 7: 24,618,782 (GRCm39) probably null Het
Art1 C G 7: 101,756,294 (GRCm39) R162G probably benign Het
Boll T A 1: 55,309,812 (GRCm39) I280F possibly damaging Het
Cep44 T C 8: 56,992,840 (GRCm39) E258G probably benign Het
Cutc T A 19: 43,748,328 (GRCm39) V75E probably damaging Het
Dtx1 T C 5: 120,819,428 (GRCm39) K590R probably damaging Het
Eps8 A T 6: 137,494,172 (GRCm39) D295E probably damaging Het
Erc2 C A 14: 27,863,248 (GRCm39) S491Y probably damaging Het
F2rl3 G T 8: 73,489,366 (GRCm39) A198S probably benign Het
Fam83b G A 9: 76,399,639 (GRCm39) T488M probably damaging Het
Fitm2 A G 2: 163,311,994 (GRCm39) L73P probably damaging Het
Fxyd1 T C 7: 30,754,228 (GRCm39) probably null Het
Gm17186 T C 14: 51,918,183 (GRCm39) noncoding transcript Het
Hivep3 C A 4: 119,591,274 (GRCm39) S94* probably null Het
Ifna1 T A 4: 88,768,349 (GRCm39) M9K probably null Het
Igsf11 G A 16: 38,843,711 (GRCm39) E275K probably damaging Het
Itga1 G A 13: 115,104,769 (GRCm39) L1086F probably benign Het
Itgav T C 2: 83,606,780 (GRCm39) S374P probably benign Het
Jmy A T 13: 93,577,641 (GRCm39) N842K probably benign Het
Kcnh6 G A 11: 105,911,557 (GRCm39) V595M possibly damaging Het
Kif13b T A 14: 64,989,088 (GRCm39) I823N probably damaging Het
Kif26b T C 1: 178,743,111 (GRCm39) L1069P probably damaging Het
Kl T A 5: 150,912,318 (GRCm39) M689K possibly damaging Het
Kmt2b G T 7: 30,287,902 (GRCm39) probably benign Het
Map10 G A 8: 126,398,328 (GRCm39) D574N probably damaging Het
Mau2 A T 8: 70,472,487 (GRCm39) H565Q probably benign Het
Myb A G 10: 21,017,668 (GRCm39) I641T probably damaging Het
Naaladl2 C A 3: 24,606,214 (GRCm39) G15V probably null Het
Or10k2 G A 8: 84,267,782 (GRCm39) C3Y probably benign Het
Or3a4 A C 11: 73,945,145 (GRCm39) S147A probably benign Het
Or6c210 A G 10: 129,495,803 (GRCm39) I43V probably benign Het
Or7d11 A T 9: 19,966,170 (GRCm39) N78K probably benign Het
Otog A G 7: 45,913,483 (GRCm39) E772G possibly damaging Het
Pmpcb A G 5: 21,942,137 (GRCm39) probably null Het
Pomk A G 8: 26,473,284 (GRCm39) V223A possibly damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Serpina1e A G 12: 103,917,066 (GRCm39) V201A probably benign Het
Six5 C T 7: 18,831,446 (GRCm39) P646S probably benign Het
Slc17a9 A G 2: 180,379,421 (GRCm39) I298V probably benign Het
Slc37a2 G T 9: 37,149,643 (GRCm39) T188K probably damaging Het
Slc6a11 T A 6: 114,222,579 (GRCm39) F525I probably benign Het
Slit2 A T 5: 48,461,516 (GRCm39) D1504V probably damaging Het
Srcap T A 7: 127,134,000 (GRCm39) M907K probably damaging Het
Sspo T C 6: 48,463,313 (GRCm39) L3746P probably benign Het
Supv3l1 A T 10: 62,271,501 (GRCm39) N376K possibly damaging Het
Tekt3 A T 11: 62,985,483 (GRCm39) T430S possibly damaging Het
Tex2 A T 11: 106,457,906 (GRCm39) V508D probably benign Het
Tmem184c G T 8: 78,323,069 (GRCm39) Q598K probably benign Het
Ube2v1 G A 2: 167,459,874 (GRCm39) R42* probably null Het
Usp45 A C 4: 21,810,797 (GRCm39) D331A probably damaging Het
Vangl1 T C 3: 102,091,835 (GRCm39) T84A probably damaging Het
Vgll3 T A 16: 65,625,064 (GRCm39) probably null Het
Vmn1r61 T A 7: 5,613,678 (GRCm39) H212L probably benign Het
Vmn2r114 A G 17: 23,510,269 (GRCm39) V737A probably benign Het
Vmn2r35 A T 7: 7,789,555 (GRCm39) D727E probably damaging Het
Vps18 T A 2: 119,128,073 (GRCm39) Y965* probably null Het
Zfp521 A T 18: 13,977,135 (GRCm39) C1093S probably damaging Het
Zfp971 A C 2: 177,675,247 (GRCm39) H282P probably benign Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120,112,207 (GRCm39) missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120,097,304 (GRCm39) missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120,111,117 (GRCm39) missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120,105,768 (GRCm39) missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R0962:Pla2g4d UTSW 2 120,111,098 (GRCm39) critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120,099,384 (GRCm39) missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120,114,648 (GRCm39) missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120,100,631 (GRCm39) splice site probably benign
R1680:Pla2g4d UTSW 2 120,108,231 (GRCm39) critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120,107,971 (GRCm39) missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120,101,622 (GRCm39) missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120,112,108 (GRCm39) splice site probably benign
R3122:Pla2g4d UTSW 2 120,109,384 (GRCm39) missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120,114,644 (GRCm39) missense probably benign
R4737:Pla2g4d UTSW 2 120,097,271 (GRCm39) missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120,097,224 (GRCm39) missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120,112,176 (GRCm39) nonsense probably null
R5530:Pla2g4d UTSW 2 120,100,036 (GRCm39) missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120,109,429 (GRCm39) missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120,100,487 (GRCm39) missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120,101,114 (GRCm39) missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120,100,830 (GRCm39) missense probably damaging 1.00
R7284:Pla2g4d UTSW 2 120,114,617 (GRCm39) missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120,109,459 (GRCm39) missense probably benign
R7552:Pla2g4d UTSW 2 120,114,620 (GRCm39) missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120,119,457 (GRCm39) missense probably benign
R7692:Pla2g4d UTSW 2 120,109,776 (GRCm39) missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120,097,211 (GRCm39) missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120,119,645 (GRCm39) start gained probably benign
R7972:Pla2g4d UTSW 2 120,109,413 (GRCm39) missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120,107,980 (GRCm39) missense probably null 1.00
R8737:Pla2g4d UTSW 2 120,100,466 (GRCm39) missense probably damaging 1.00
R8752:Pla2g4d UTSW 2 120,099,248 (GRCm39) critical splice donor site probably null
R8987:Pla2g4d UTSW 2 120,100,442 (GRCm39) missense probably damaging 1.00
R9221:Pla2g4d UTSW 2 120,100,453 (GRCm39) missense possibly damaging 0.76
R9251:Pla2g4d UTSW 2 120,099,378 (GRCm39) missense possibly damaging 0.87
R9740:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 1.00
X0026:Pla2g4d UTSW 2 120,107,952 (GRCm39) missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120,112,207 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCTCAGAGCTCAACCAC -3'
(R):5'- GAGAGTTGCCGTTACCTATGG -3'

Sequencing Primer
(F):5'- GCCCTTCCCAATGGAGGAC -3'
(R):5'- GAAGGGTGACTGCTTCTAACC -3'
Posted On 2017-10-10