Incidental Mutation 'R6150:Ube2v1'
ID489170
Institutional Source Beutler Lab
Gene Symbol Ube2v1
Ensembl Gene ENSMUSG00000078923
Gene Nameubiquitin-conjugating enzyme E2 variant 1
SynonymsD7Bwg1382e, CROC1, 0610011J09Rik
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location167607638-167632095 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 167617954 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 42 (R42*)
Ref Sequence ENSEMBL: ENSMUSP00000114764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060645] [ENSMUST00000109207] [ENSMUST00000125544] [ENSMUST00000140216] [ENSMUST00000151365]
Predicted Effect probably null
Transcript: ENSMUST00000060645
AA Change: R16*
SMART Domains Protein: ENSMUSP00000053109
Gene: ENSMUSG00000078923
AA Change: R16*

DomainStartEndE-ValueType
PDB:2C2V|L 7 105 7e-59 PDB
SCOP:d1jatb_ 10 103 4e-31 SMART
Blast:UBCc 15 105 1e-54 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109207
AA Change: R16*
SMART Domains Protein: ENSMUSP00000104830
Gene: ENSMUSG00000078923
AA Change: R16*

DomainStartEndE-ValueType
UBCc 15 147 1.53e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125544
AA Change: R240*
SMART Domains Protein: ENSMUSP00000118416
Gene: ENSMUSG00000089739
AA Change: R240*

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
UBCc 239 371 1.53e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130284
Predicted Effect probably null
Transcript: ENSMUST00000140216
AA Change: R43*
SMART Domains Protein: ENSMUSP00000116578
Gene: ENSMUSG00000078923
AA Change: R43*

DomainStartEndE-ValueType
UBCc 42 125 6.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144830
Predicted Effect probably null
Transcript: ENSMUST00000151365
AA Change: R42*
SMART Domains Protein: ENSMUSP00000114764
Gene: ENSMUSG00000078923
AA Change: R42*

DomainStartEndE-ValueType
UBCc 41 173 1.53e-14 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene is located in the nucleus and can cause transcriptional activation of the human FOS proto-oncogene. It is thought to be involved in the control of differentiation by altering cell cycle behavior. Alternatively spliced transcript variants encoding multiple isoforms have been described for this gene, and multiple pseudogenes of this gene have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (Kua-UEV), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Ube2v1
AlleleSourceChrCoordTypePredicted EffectPPH Score
ANU74:Ube2v1 UTSW 2 167610344 missense probably damaging 1.00
R1219:Ube2v1 UTSW 2 167617911 missense probably benign 0.20
R2862:Ube2v1 UTSW 2 167617965 missense probably damaging 1.00
R2971:Ube2v1 UTSW 2 167610336 missense probably damaging 1.00
R4666:Ube2v1 UTSW 2 167610377 missense probably damaging 1.00
R4894:Ube2v1 UTSW 2 167610360 missense probably damaging 0.99
R7260:Ube2v1 UTSW 2 167629194 missense probably benign 0.02
R7356:Ube2v1 UTSW 2 167609195 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCTTTAAGGAAAGGCACAGTG -3'
(R):5'- TTGGCATTCCTCTCAGCCAG -3'

Sequencing Primer
(F):5'- AGGCACAGTGAGCTTAACTC -3'
(R):5'- CTAAACGGGGTGGGGCAC -3'
Posted On2017-10-10