Incidental Mutation 'R6150:Usp45'
ID489175
Institutional Source Beutler Lab
Gene Symbol Usp45
Ensembl Gene ENSMUSG00000040455
Gene Nameubiquitin specific petidase 45
SynonymsGcap7, 3110003C05Rik, 4930550B20Rik
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location21767156-21837872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 21810797 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 331 (D331A)
Ref Sequence ENSEMBL: ENSMUSP00000103867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040429] [ENSMUST00000065111] [ENSMUST00000108232] [ENSMUST00000148647]
Predicted Effect probably damaging
Transcript: ENSMUST00000040429
AA Change: D331A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048324
Gene: ENSMUSG00000040455
AA Change: D331A

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2e-19 PFAM
Pfam:UCH 190 761 2.8e-50 PFAM
Pfam:UCH_1 533 743 3.9e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065111
AA Change: D331A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067109
Gene: ENSMUSG00000040455
AA Change: D331A

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 4.1e-19 PFAM
Pfam:UCH 190 809 2.1e-45 PFAM
Pfam:UCH_1 581 790 9.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108232
AA Change: D331A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103867
Gene: ENSMUSG00000040455
AA Change: D331A

DomainStartEndE-ValueType
Pfam:zf-UBP 60 139 2.2e-19 PFAM
Pfam:UCH 190 809 4.6e-50 PFAM
Pfam:UCH_1 582 791 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137293
SMART Domains Protein: ENSMUSP00000125982
Gene: ENSMUSG00000040455

DomainStartEndE-ValueType
Pfam:zf-UBP 27 106 1.6e-20 PFAM
Pfam:UCH 157 205 3.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148647
SMART Domains Protein: ENSMUSP00000128859
Gene: ENSMUSG00000040455

DomainStartEndE-ValueType
Pfam:UCH 54 150 4.6e-9 PFAM
Meta Mutation Damage Score 0.5023 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Vangl1 T C 3: 102,184,519 T84A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Usp45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Usp45 APN 4 21830433 missense probably benign 0.38
IGL02053:Usp45 APN 4 21824553 missense probably benign 0.43
IGL02155:Usp45 APN 4 21798743 unclassified probably null
R0285:Usp45 UTSW 4 21798603 critical splice acceptor site probably null
R1260:Usp45 UTSW 4 21826204 missense probably damaging 1.00
R1495:Usp45 UTSW 4 21797385 missense possibly damaging 0.82
R1888:Usp45 UTSW 4 21784811 intron probably benign
R2444:Usp45 UTSW 4 21817528 missense probably benign 0.00
R2906:Usp45 UTSW 4 21834338 nonsense probably null
R4058:Usp45 UTSW 4 21810746 missense probably damaging 1.00
R4357:Usp45 UTSW 4 21834350 nonsense probably null
R4386:Usp45 UTSW 4 21830505 critical splice donor site probably null
R4648:Usp45 UTSW 4 21825044 missense probably benign 0.12
R4766:Usp45 UTSW 4 21797307 missense probably damaging 0.98
R4787:Usp45 UTSW 4 21796860 missense probably benign
R4973:Usp45 UTSW 4 21815372 missense probably damaging 1.00
R5152:Usp45 UTSW 4 21824815 missense probably benign 0.41
R5900:Usp45 UTSW 4 21830451 missense probably damaging 1.00
R5960:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R5961:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6149:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6151:Usp45 UTSW 4 21810797 missense probably damaging 1.00
R6997:Usp45 UTSW 4 21781844 missense probably damaging 1.00
R7504:Usp45 UTSW 4 21816892 missense possibly damaging 0.65
R7565:Usp45 UTSW 4 21784790 missense probably benign 0.00
R7750:Usp45 UTSW 4 21780430 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGGCTCAGTCTTACAAAAC -3'
(R):5'- AAGGAGAGGCTTTACGACCC -3'

Sequencing Primer
(F):5'- AGGCTCAGTCTTACAAAACAATTC -3'
(R):5'- CACAGTGGCTGGAAGTTCCTG -3'
Posted On2017-10-10